ID: 1180821734

View in Genome Browser
Species Human (GRCh38)
Location 22:18833573-18833595
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821734_1180821740 -9 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821740 22:18833587-18833609 GGTGCTGGGCCCTTGGAAATCGG No data
1180821734_1180821746 1 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821746 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
1180821734_1180821750 28 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821750 22:18833624-18833646 TGCTCGAGCTGAGCGCGAGAGGG No data
1180821734_1180821742 -1 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821742 22:18833595-18833617 GCCCTTGGAAATCGGCGCGTGGG No data
1180821734_1180821749 27 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821749 22:18833623-18833645 GTGCTCGAGCTGAGCGCGAGAGG No data
1180821734_1180821748 5 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821748 22:18833601-18833623 GGAAATCGGCGCGTGGGGGGCGG No data
1180821734_1180821747 2 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data
1180821734_1180821741 -2 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821741 22:18833594-18833616 GGCCCTTGGAAATCGGCGCGTGG No data
1180821734_1180821744 0 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821744 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821734 Original CRISPR CCCAGCACCTAAGGGGTCCG CGG (reversed) Intergenic