ID: 1180821739

View in Genome Browser
Species Human (GRCh38)
Location 22:18833582-18833604
Sequence TTCCAAGGGCCCAGCACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821739_1180821744 -9 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821744 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
1180821739_1180821751 22 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821751 22:18833627-18833649 TCGAGCTGAGCGCGAGAGGGCGG No data
1180821739_1180821748 -4 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821748 22:18833601-18833623 GGAAATCGGCGCGTGGGGGGCGG No data
1180821739_1180821742 -10 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821742 22:18833595-18833617 GCCCTTGGAAATCGGCGCGTGGG No data
1180821739_1180821752 23 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821752 22:18833628-18833650 CGAGCTGAGCGCGAGAGGGCGGG No data
1180821739_1180821749 18 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821749 22:18833623-18833645 GTGCTCGAGCTGAGCGCGAGAGG No data
1180821739_1180821750 19 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821750 22:18833624-18833646 TGCTCGAGCTGAGCGCGAGAGGG No data
1180821739_1180821746 -8 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821746 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
1180821739_1180821747 -7 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821739 Original CRISPR TTCCAAGGGCCCAGCACCTA AGG (reversed) Intergenic