ID: 1180821743

View in Genome Browser
Species Human (GRCh38)
Location 22:18833596-18833618
Sequence CCCCACGCGCCGATTTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821743_1180821750 5 Left 1180821743 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1180821750 22:18833624-18833646 TGCTCGAGCTGAGCGCGAGAGGG No data
1180821743_1180821755 22 Left 1180821743 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1180821755 22:18833641-18833663 AGAGGGCGGGAGAGCTCGTGGGG No data
1180821743_1180821754 21 Left 1180821743 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1180821754 22:18833640-18833662 GAGAGGGCGGGAGAGCTCGTGGG No data
1180821743_1180821751 8 Left 1180821743 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1180821751 22:18833627-18833649 TCGAGCTGAGCGCGAGAGGGCGG No data
1180821743_1180821753 20 Left 1180821743 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1180821753 22:18833639-18833661 CGAGAGGGCGGGAGAGCTCGTGG No data
1180821743_1180821752 9 Left 1180821743 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1180821752 22:18833628-18833650 CGAGCTGAGCGCGAGAGGGCGGG No data
1180821743_1180821749 4 Left 1180821743 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1180821749 22:18833623-18833645 GTGCTCGAGCTGAGCGCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821743 Original CRISPR CCCCACGCGCCGATTTCCAA GGG (reversed) Intergenic