ID: 1180821745

View in Genome Browser
Species Human (GRCh38)
Location 22:18833597-18833619
Sequence CCCCCACGCGCCGATTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821745_1180821755 21 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821755 22:18833641-18833663 AGAGGGCGGGAGAGCTCGTGGGG No data
1180821745_1180821751 7 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821751 22:18833627-18833649 TCGAGCTGAGCGCGAGAGGGCGG No data
1180821745_1180821752 8 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821752 22:18833628-18833650 CGAGCTGAGCGCGAGAGGGCGGG No data
1180821745_1180821754 20 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821754 22:18833640-18833662 GAGAGGGCGGGAGAGCTCGTGGG No data
1180821745_1180821749 3 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821749 22:18833623-18833645 GTGCTCGAGCTGAGCGCGAGAGG No data
1180821745_1180821756 30 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821756 22:18833650-18833672 GAGAGCTCGTGGGGTGCGAGAGG No data
1180821745_1180821753 19 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821753 22:18833639-18833661 CGAGAGGGCGGGAGAGCTCGTGG No data
1180821745_1180821750 4 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821750 22:18833624-18833646 TGCTCGAGCTGAGCGCGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821745 Original CRISPR CCCCCACGCGCCGATTTCCA AGG (reversed) Intergenic
No off target data available for this crispr