ID: 1180821747 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:18833598-18833620 |
Sequence | CTTGGAAATCGGCGCGTGGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 7 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180821738_1180821747 | -6 | Left | 1180821738 | 22:18833581-18833603 | CCCTTAGGTGCTGGGCCCTTGGA | No data | ||
Right | 1180821747 | 22:18833598-18833620 | CTTGGAAATCGGCGCGTGGGGGG | No data | ||||
1180821739_1180821747 | -7 | Left | 1180821739 | 22:18833582-18833604 | CCTTAGGTGCTGGGCCCTTGGAA | No data | ||
Right | 1180821747 | 22:18833598-18833620 | CTTGGAAATCGGCGCGTGGGGGG | No data | ||||
1180821726_1180821747 | 29 | Left | 1180821726 | 22:18833546-18833568 | CCTAGCCGGGCGACGCCTCGGAG | 0: 5 1: 1 2: 0 3: 4 4: 48 |
||
Right | 1180821747 | 22:18833598-18833620 | CTTGGAAATCGGCGCGTGGGGGG | No data | ||||
1180821736_1180821747 | -5 | Left | 1180821736 | 22:18833580-18833602 | CCCCTTAGGTGCTGGGCCCTTGG | No data | ||
Right | 1180821747 | 22:18833598-18833620 | CTTGGAAATCGGCGCGTGGGGGG | No data | ||||
1180821734_1180821747 | 2 | Left | 1180821734 | 22:18833573-18833595 | CCGCGGACCCCTTAGGTGCTGGG | No data | ||
Right | 1180821747 | 22:18833598-18833620 | CTTGGAAATCGGCGCGTGGGGGG | No data | ||||
1180821731_1180821747 | 14 | Left | 1180821731 | 22:18833561-18833583 | CCTCGGAGGAGGCCGCGGACCCC | No data | ||
Right | 1180821747 | 22:18833598-18833620 | CTTGGAAATCGGCGCGTGGGGGG | No data | ||||
1180821729_1180821747 | 24 | Left | 1180821729 | 22:18833551-18833573 | CCGGGCGACGCCTCGGAGGAGGC | No data | ||
Right | 1180821747 | 22:18833598-18833620 | CTTGGAAATCGGCGCGTGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180821747 | Original CRISPR | CTTGGAAATCGGCGCGTGGG GGG | Intergenic | ||