ID: 1180821747

View in Genome Browser
Species Human (GRCh38)
Location 22:18833598-18833620
Sequence CTTGGAAATCGGCGCGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821731_1180821747 14 Left 1180821731 22:18833561-18833583 CCTCGGAGGAGGCCGCGGACCCC No data
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data
1180821729_1180821747 24 Left 1180821729 22:18833551-18833573 CCGGGCGACGCCTCGGAGGAGGC No data
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data
1180821736_1180821747 -5 Left 1180821736 22:18833580-18833602 CCCCTTAGGTGCTGGGCCCTTGG No data
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data
1180821734_1180821747 2 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data
1180821738_1180821747 -6 Left 1180821738 22:18833581-18833603 CCCTTAGGTGCTGGGCCCTTGGA No data
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data
1180821726_1180821747 29 Left 1180821726 22:18833546-18833568 CCTAGCCGGGCGACGCCTCGGAG 0: 5
1: 1
2: 0
3: 4
4: 48
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data
1180821739_1180821747 -7 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821747 22:18833598-18833620 CTTGGAAATCGGCGCGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821747 Original CRISPR CTTGGAAATCGGCGCGTGGG GGG Intergenic