ID: 1180821748

View in Genome Browser
Species Human (GRCh38)
Location 22:18833601-18833623
Sequence GGAAATCGGCGCGTGGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821739_1180821748 -4 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821748 22:18833601-18833623 GGAAATCGGCGCGTGGGGGGCGG No data
1180821738_1180821748 -3 Left 1180821738 22:18833581-18833603 CCCTTAGGTGCTGGGCCCTTGGA No data
Right 1180821748 22:18833601-18833623 GGAAATCGGCGCGTGGGGGGCGG No data
1180821734_1180821748 5 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821748 22:18833601-18833623 GGAAATCGGCGCGTGGGGGGCGG No data
1180821736_1180821748 -2 Left 1180821736 22:18833580-18833602 CCCCTTAGGTGCTGGGCCCTTGG No data
Right 1180821748 22:18833601-18833623 GGAAATCGGCGCGTGGGGGGCGG No data
1180821731_1180821748 17 Left 1180821731 22:18833561-18833583 CCTCGGAGGAGGCCGCGGACCCC No data
Right 1180821748 22:18833601-18833623 GGAAATCGGCGCGTGGGGGGCGG No data
1180821729_1180821748 27 Left 1180821729 22:18833551-18833573 CCGGGCGACGCCTCGGAGGAGGC No data
Right 1180821748 22:18833601-18833623 GGAAATCGGCGCGTGGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821748 Original CRISPR GGAAATCGGCGCGTGGGGGG CGG Intergenic