ID: 1180821750

View in Genome Browser
Species Human (GRCh38)
Location 22:18833624-18833646
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821738_1180821750 20 Left 1180821738 22:18833581-18833603 CCCTTAGGTGCTGGGCCCTTGGA No data
Right 1180821750 22:18833624-18833646 TGCTCGAGCTGAGCGCGAGAGGG No data
1180821734_1180821750 28 Left 1180821734 22:18833573-18833595 CCGCGGACCCCTTAGGTGCTGGG No data
Right 1180821750 22:18833624-18833646 TGCTCGAGCTGAGCGCGAGAGGG No data
1180821736_1180821750 21 Left 1180821736 22:18833580-18833602 CCCCTTAGGTGCTGGGCCCTTGG No data
Right 1180821750 22:18833624-18833646 TGCTCGAGCTGAGCGCGAGAGGG No data
1180821745_1180821750 4 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821750 22:18833624-18833646 TGCTCGAGCTGAGCGCGAGAGGG No data
1180821743_1180821750 5 Left 1180821743 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1180821750 22:18833624-18833646 TGCTCGAGCTGAGCGCGAGAGGG No data
1180821739_1180821750 19 Left 1180821739 22:18833582-18833604 CCTTAGGTGCTGGGCCCTTGGAA No data
Right 1180821750 22:18833624-18833646 TGCTCGAGCTGAGCGCGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821750 Original CRISPR TGCTCGAGCTGAGCGCGAGA GGG Intergenic