ID: 1180821754

View in Genome Browser
Species Human (GRCh38)
Location 22:18833640-18833662
Sequence GAGAGGGCGGGAGAGCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821745_1180821754 20 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821754 22:18833640-18833662 GAGAGGGCGGGAGAGCTCGTGGG No data
1180821743_1180821754 21 Left 1180821743 22:18833596-18833618 CCCTTGGAAATCGGCGCGTGGGG No data
Right 1180821754 22:18833640-18833662 GAGAGGGCGGGAGAGCTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821754 Original CRISPR GAGAGGGCGGGAGAGCTCGT GGG Intergenic
No off target data available for this crispr