ID: 1180821756

View in Genome Browser
Species Human (GRCh38)
Location 22:18833650-18833672
Sequence GAGAGCTCGTGGGGTGCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180821745_1180821756 30 Left 1180821745 22:18833597-18833619 CCTTGGAAATCGGCGCGTGGGGG No data
Right 1180821756 22:18833650-18833672 GAGAGCTCGTGGGGTGCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180821756 Original CRISPR GAGAGCTCGTGGGGTGCGAG AGG Intergenic