ID: 1180823582

View in Genome Browser
Species Human (GRCh38)
Location 22:18848122-18848144
Sequence GCTGAGGCCCAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 766
Summary {0: 14, 1: 25, 2: 11, 3: 102, 4: 614}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180823582_1180823586 2 Left 1180823582 22:18848122-18848144 CCTTCACATTTCTGGGCCTCAGC 0: 14
1: 25
2: 11
3: 102
4: 614
Right 1180823586 22:18848147-18848169 CAGCTGCAGCAGGTGCCCAGAGG 0: 18
1: 16
2: 13
3: 55
4: 481
1180823582_1180823589 30 Left 1180823582 22:18848122-18848144 CCTTCACATTTCTGGGCCTCAGC 0: 14
1: 25
2: 11
3: 102
4: 614
Right 1180823589 22:18848175-18848197 ACCAGAGATCCCAGACCTCCCGG 0: 38
1: 14
2: 9
3: 38
4: 253
1180823582_1180823583 -8 Left 1180823582 22:18848122-18848144 CCTTCACATTTCTGGGCCTCAGC 0: 14
1: 25
2: 11
3: 102
4: 614
Right 1180823583 22:18848137-18848159 GCCTCAGCCACAGCTGCAGCAGG 0: 18
1: 2
2: 5
3: 200
4: 3037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180823582 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG (reversed) Exonic
900312631 1:2041566-2041588 CCCGAGGCCCAGCAAAGTGAGGG + Intergenic
900655515 1:3754913-3754935 CCTGAAGCCTAGAAAGGTGAGGG - Intronic
900680352 1:3912965-3912987 GCTGAGCCCCCGAGATGTGCAGG + Intergenic
900967510 1:5969177-5969199 GCTGAGGGCAAGAAACGGGATGG - Exonic
901537083 1:9889472-9889494 GCAGAGGCCCAGAGATGTGGAGG - Intronic
901988989 1:13097305-13097327 GCAGAGGCTCAGAACTTTGAAGG + Intergenic
901992824 1:13129462-13129484 GCAGAGGCTCAGAACTTTGAAGG - Intergenic
902028734 1:13405082-13405104 GCTGAGGCACAGAGAGGTTAAGG - Intergenic
902438960 1:16416768-16416790 CCTGAGCCCCAGAAATAGGATGG + Intronic
902532977 1:17102466-17102488 GGTGAGGCCCAGAGAGGTTAGGG - Intronic
902619235 1:17640981-17641003 TCTGAGGCCCAGAGATGTGCGGG + Intronic
902763824 1:18601682-18601704 ACTGAGGCCCAGAGGGGTGATGG - Intergenic
902792340 1:18777902-18777924 ACTGAGGCCCAAACATGGGAAGG + Intergenic
902885982 1:19405121-19405143 TCTGAGACCCAGAGATGAGAAGG - Intronic
902936377 1:19767761-19767783 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
903016400 1:20364914-20364936 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
903049763 1:20591793-20591815 GCTGACACTCAGAAAGGTGAAGG - Intronic
903228507 1:21907364-21907386 TCTGAGGCCCAGAGAAGGGAAGG - Intronic
903326098 1:22569445-22569467 GCAGAGGCCCAGAGAGGTCAAGG + Intronic
903352695 1:22727472-22727494 GCTGAGGCCCAGCAAGGTACTGG - Intronic
903465003 1:23545882-23545904 GCTGAGACCCAGAAATAAGAAGG - Intergenic
903573613 1:24323967-24323989 GCTGAGGACAAAAAAGGTGAAGG - Intronic
903577105 1:24345758-24345780 GCTGAGGCTCAGAGAGGTGAAGG - Intronic
903581991 1:24377872-24377894 GCTAAGGCTCAGAGAGGTGAAGG - Intronic
903669305 1:25026026-25026048 GCTGAGGCCCAGCAAAGGCAGGG + Intergenic
903934160 1:26883350-26883372 ACAGAGGCCCAGAAATGAGAGGG - Intronic
904047395 1:27616774-27616796 ACTGAGGCCCAGAGAAGGGAAGG - Intronic
904394059 1:30206181-30206203 GCTGTAGCCCAGGAATGTCAGGG - Intergenic
904619573 1:31767090-31767112 ACAGAGGCCCAGAAAGCTGAAGG - Intergenic
904994288 1:34618913-34618935 ACTGAGACCCAGTAATCTGAAGG + Intergenic
905731392 1:40301423-40301445 TCTCAGGCCCAGAATTTTGAAGG + Intronic
905872242 1:41411742-41411764 GCTGAGACCCAGAGATGGGTGGG + Intergenic
905975241 1:42169416-42169438 ACTGAGGCTCAGAAAGGTCATGG - Intergenic
906046985 1:42838735-42838757 GTTCAGACCCAGAAATCTGATGG - Intronic
906084791 1:43122254-43122276 ACTGAGGCCCAGAGAGGTTAAGG - Intergenic
906159980 1:43640961-43640983 AATGAGGCCCTGAAAGGTGAGGG + Intergenic
906193494 1:43914300-43914322 ACTAAGGCCCAGAATGGTGAGGG - Intronic
906528136 1:46508367-46508389 GCAAAGGCACAGAAATGGGATGG + Intronic
906679825 1:47718674-47718696 ACTGAGGCCCAGAAAAGGGCAGG - Intergenic
906698152 1:47838747-47838769 GCTGACGCCCAGAAGAGTAAGGG + Intronic
906711149 1:47930808-47930830 ACTGAGGCCCAGAAAGGAAAAGG + Intronic
906801486 1:48741323-48741345 GCCGAGACCCAGAGAAGTGAAGG + Intronic
906845175 1:49183990-49184012 ACTGAGGCCCAGAAAGGTGAAGG + Intronic
907049861 1:51322641-51322663 GCTGAGACCCAGAAAAGTCAGGG - Intronic
907276733 1:53320956-53320978 ACTGAGGCTCAGAAAGGAGACGG - Intronic
907320794 1:53601007-53601029 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
907391424 1:54160791-54160813 CCTGAGGCCCAGCAACGTGAAGG + Intronic
907623263 1:56003717-56003739 ACTGAGGCCCAGAAAAGTATCGG - Intergenic
907750375 1:57257509-57257531 ACTGAGGCCAAGATAGGTGATGG + Intronic
907966283 1:59333039-59333061 ACTGAGGCTCAGAAAGTTGATGG + Intronic
908498040 1:64714628-64714650 GCTGAGACACAGAAAGGTTAAGG + Intergenic
908678067 1:66628361-66628383 ACTGAGGCCCAGCAAAGTAAAGG - Intronic
908792262 1:67794439-67794461 CATGAGGCACAGAACTGTGACGG + Intronic
909603715 1:77487658-77487680 ACTGAGGCCCAGAGAAGTTAAGG + Intronic
909823581 1:80097830-80097852 GGTGAGGCCCAGTACTGTGCTGG - Intergenic
910503404 1:87921206-87921228 ACTGAGGCTGAGAAAGGTGAAGG + Intergenic
911263799 1:95719370-95719392 ACTGAGACCCAGAAAGGTGATGG - Intergenic
911496594 1:98638405-98638427 GGTGAGGCCCAGCACTGTGCTGG + Intergenic
912456031 1:109798026-109798048 GCTGAGGCCCAGACATTGCAGGG - Intergenic
912701508 1:111881716-111881738 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
913286609 1:117232485-117232507 ACTGAGGCACAGAAAGGTGAAGG - Intergenic
915108270 1:153547528-153547550 TAGGAGGCCCAGAGATGTGAGGG - Exonic
915522531 1:156456248-156456270 GCTGACGCTCAGGAAGGTGAAGG - Intergenic
915676244 1:157534835-157534857 GCTGAGGCCCTGACTTTTGAAGG - Exonic
915686122 1:157636517-157636539 GCTGAGGCCCTGACTTTTGAAGG - Intergenic
915836912 1:159184289-159184311 GCTGCGGCCCAGAATACTGAAGG - Intronic
917840760 1:178975480-178975502 GATGAGACCCAGTAATGTGCTGG + Intergenic
920050837 1:203163887-203163909 CCTGAGACCCAGGAGTGTGAAGG - Intronic
920091189 1:203454407-203454429 ACTGAGGCACAGAAAGGTCAAGG - Intergenic
920114078 1:203607589-203607611 GCTGAGACCCAGAGAGCTGAAGG - Intergenic
920341898 1:205280357-205280379 GCTGAGGCTCAGAAGGATGAAGG + Intergenic
920640058 1:207743157-207743179 TCTGAGGCCCTGCAATGAGAAGG - Intergenic
920801646 1:209194051-209194073 GCTGAGGCCCAGAGAGGGCATGG - Intergenic
920919168 1:210284090-210284112 TCTGAGGCACAGACAGGTGAGGG + Intergenic
921308385 1:213819453-213819475 GATGGGGCCCAGGAATCTGAAGG + Intergenic
921398650 1:214695332-214695354 GCTCATGCTCAGAAATGTTAGGG + Intergenic
922154796 1:223032363-223032385 ACTGAGGCCCAGAGAGGTTAAGG - Intergenic
922216726 1:223526107-223526129 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
922418803 1:225445761-225445783 CCTGAGGCCCAGAGAAGGGATGG - Intergenic
922749501 1:228063949-228063971 GCTGGGGCCCAGAGAGGAGATGG + Intergenic
922824049 1:228504829-228504851 ACTGGGGCCCAGAAATCTGCAGG + Intergenic
923144917 1:231191010-231191032 ACTGAGGCTCAGAAATATGGTGG - Intronic
1063184787 10:3640989-3641011 GGTGAGGACCGGAAATGTGCAGG - Intergenic
1063437393 10:6045423-6045445 TCTGAGGTCCCAAAATGTGATGG - Intronic
1063637894 10:7801592-7801614 GCTTAGGACCAGAAATGTTTGGG + Intronic
1063886101 10:10580562-10580584 ACTGAGGCCCAGAAAAATGAAGG - Intergenic
1063970599 10:11379000-11379022 GCTGAGGCCCAGAGAGGGCAAGG - Intergenic
1064598580 10:16970773-16970795 ACTGAGATCCAGAAATGTCAGGG - Intronic
1064625796 10:17259979-17260001 TCTGAGGCCTAGAAAAGTTAAGG - Intergenic
1064726456 10:18284769-18284791 GCTTGGTCCTAGAAATGTGAAGG + Intronic
1065112350 10:22452644-22452666 ACGGAGGCCCAGAGAGGTGAGGG + Intronic
1066433671 10:35376653-35376675 GCTTAGGACCAGAAATGTTCTGG - Intronic
1067693253 10:48517979-48518001 GCAGAGGCTCAGAGGTGTGAGGG + Intronic
1069716177 10:70522890-70522912 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
1069800974 10:71081239-71081261 ACTGAGGCCCAGAGAGGGGACGG + Intergenic
1070338222 10:75473653-75473675 ACTGAGCCACAGAAATGTTAAGG - Intronic
1070384032 10:75907872-75907894 GTTGAGGTCCAGAAAAGTTAAGG + Intronic
1070774971 10:79104136-79104158 TCTGAGGCCCAGAGAGGGGAGGG - Intronic
1070778797 10:79125813-79125835 ACTGAGGCCCAGAGATAGGAGGG + Intronic
1070827858 10:79401628-79401650 ACTGAGGCCCAGAGATGGGGAGG - Intronic
1071483858 10:86085143-86085165 GATGAGCCCCAGACATGGGAGGG + Intronic
1071525026 10:86353619-86353641 GCTGGGGCCCAGCTCTGTGAAGG - Intronic
1071553686 10:86586254-86586276 ACTGAGGCCCAGAAAAGGGTGGG - Intergenic
1071602698 10:86966632-86966654 GTTGAGGCTCAGAGAAGTGAGGG + Intronic
1071703112 10:87964011-87964033 GCTAAGGCCCAGAAAGGTTAGGG - Intronic
1072283940 10:93894865-93894887 AGTGAGGCCCAGGAAGGTGAGGG + Intronic
1072708990 10:97703340-97703362 GCTGAGGTGAAGAAATGTGCAGG + Intergenic
1073079966 10:100853503-100853525 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1073114367 10:101082981-101083003 GCTGAAGCCTAGAAACGGGATGG - Intergenic
1073298173 10:102453813-102453835 GCTGATGCCCAGAAGTCTGGTGG - Intergenic
1074092269 10:110272301-110272323 GCTTAGGACCAGAAATGTTTTGG - Intronic
1074859280 10:117498004-117498026 GCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1075530203 10:123222626-123222648 GCTGAGGCCAAGAATTGGCATGG + Intergenic
1075703114 10:124482040-124482062 ACTGAATCCCAGAAATGTCAAGG - Intronic
1076531399 10:131147615-131147637 GCCGAGGCCCAGAGAGGGGAGGG - Intronic
1077488245 11:2848819-2848841 GCTGAGCCGCAGAGAAGTGACGG + Exonic
1078094902 11:8290732-8290754 GCAGAGGCCCAGCAATGGGCAGG - Intergenic
1078634009 11:13031910-13031932 TCTGAGGTCCAGAAATGAAAAGG - Intergenic
1078883189 11:15473643-15473665 ACTGAGGACCAGAAATAAGAAGG + Intergenic
1079251429 11:18790826-18790848 ACTGAGGCCCAGTAAGGTGGCGG - Intronic
1080265882 11:30401506-30401528 GATGAGGCTCAGAAGTGTGATGG - Intronic
1080948147 11:36998177-36998199 CCTGAGTCCCACAGATGTGAAGG - Intergenic
1081447601 11:43145683-43145705 AATGGGGCCCAGAAATGTCAGGG - Intergenic
1081582203 11:44360065-44360087 ACTGAGGCTCAGAAAGGTTAAGG + Intergenic
1081636059 11:44723049-44723071 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1081660205 11:44883510-44883532 GCTGAGGCTCAGAAAGGCCAAGG + Intronic
1081751150 11:45512084-45512106 GCTGAGGCCCAGAAAAAGGAAGG + Intergenic
1081757123 11:45552591-45552613 GCTGAGTCTCAGAAATGTCCTGG - Intergenic
1081795645 11:45817486-45817508 AGTGAGGCCCAGAAAGGTTAGGG - Intergenic
1081813789 11:45927674-45927696 ACTGAGGCCCAGAAAGGAGCAGG - Intronic
1082770488 11:57203908-57203930 ACTGAGGCTTAGAAATGGGAAGG - Intergenic
1083005226 11:59338396-59338418 ACTTAGGCACAGAAATGTGAAGG - Intergenic
1083639430 11:64137294-64137316 GCTGGGGCACAGCCATGTGAGGG + Intronic
1083791269 11:64987792-64987814 ACTGAGGCTCAGAGATGAGACGG - Intergenic
1083886428 11:65575717-65575739 ACTGAGACCCAGAAAGGGGAAGG - Intergenic
1084448225 11:69216711-69216733 TCTAAGGCCAAGAAATGTGTCGG - Intergenic
1084532002 11:69732844-69732866 ACTGAGGCTCAGAGAGGTGAGGG + Intergenic
1084789366 11:71463654-71463676 GCTGAGACCCAGAAAAGCAAAGG - Intronic
1085052282 11:73386110-73386132 ACTGAGACCCAGTGATGTGAAGG + Intronic
1085201959 11:74707230-74707252 ACTGAGGCCCAGAGAAGGGAAGG + Intronic
1085449264 11:76622292-76622314 GCTGAGGCCCAGAGGTGGGGAGG + Intergenic
1085705875 11:78786524-78786546 ACTGAGGCTCAGAAAGTTGACGG + Intronic
1085709583 11:78816942-78816964 GGTGAGGCCCAGAGAGGGGAAGG - Intronic
1085835382 11:79950432-79950454 GCTGAGGTCCAAAATTCTGACGG + Intergenic
1086010569 11:82098294-82098316 TCTGAGGCTCAGAAATATGAAGG - Intergenic
1086046932 11:82543848-82543870 ACTGAGGTCCAGAAAGGTTAGGG + Intergenic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1088383367 11:109221356-109221378 GCTGAGGCCCAGGGAGATGAGGG + Intergenic
1088750193 11:112836490-112836512 GCTGAGGCCTATAAATCTGCAGG - Intergenic
1088911651 11:114196886-114196908 ACTGAGTCCCAGAAAGGTTAAGG + Intronic
1088994805 11:114986948-114986970 ACTGAGGTCCAGAGATGTGAGGG + Intergenic
1089282421 11:117383679-117383701 ACTGAGGCTCAGAGAAGTGAAGG + Intronic
1089329151 11:117677783-117677805 ACTGAGGCACAGACAGGTGAAGG + Intronic
1089402306 11:118171404-118171426 GCAGAGGCCCAGAGCTCTGAGGG + Intronic
1090047949 11:123352390-123352412 GCTGAGGCTCAGAGAGGTGAAGG - Intergenic
1090117252 11:123986297-123986319 ACTGAGGCTCAGAAATTTCAAGG - Intergenic
1090989813 11:131806599-131806621 AATGAGGCCCAGAAAGGAGAAGG + Intronic
1091632676 12:2173744-2173766 ACTGAGGCACAGAAAGGTTAAGG - Intronic
1091768708 12:3138037-3138059 GCTGAGGCCCAGAGAAGGCAAGG - Intronic
1093802048 12:23385772-23385794 GCTGAGTTCCTGAAATGAGATGG - Intergenic
1095521422 12:43071409-43071431 TTTGAGGCCCAGAAAAGTTAAGG + Intergenic
1096251846 12:50038500-50038522 GATGAGGCCTAGAAAGGGGAAGG - Intergenic
1096370949 12:51068548-51068570 GCTTGGACCCAGAAAGGTGATGG - Intronic
1096394507 12:51255560-51255582 GCTGACTGCCAGACATGTGAGGG + Intronic
1096862532 12:54540204-54540226 TCCGAGGCCCAGAAATGCTAGGG + Intronic
1096932416 12:55227011-55227033 GCTGATTCCCAAAAATGTGGAGG + Intergenic
1098092744 12:66921493-66921515 CATGGGGCCCAGAAATGGGAAGG - Intergenic
1098719193 12:73873798-73873820 GCTGAGGCTCAGAACTCTGTGGG - Intergenic
1098870898 12:75815833-75815855 ACTGAGGCCCAGAAAGGAGAAGG + Intergenic
1099742859 12:86663646-86663668 ACTCAGGAACAGAAATGTGATGG + Intronic
1100948609 12:99818941-99818963 GTTGAGGCAAAGAAATTTGAAGG - Intronic
1101347419 12:103899519-103899541 ACTGAGGCCCAGAGAAGTGAAGG + Intergenic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1101960311 12:109244355-109244377 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1101963825 12:109268593-109268615 GCTGAGGCACAGAGAGGTGAAGG + Intergenic
1101990270 12:109478117-109478139 ACTGAGGCTCAGAGAGGTGAGGG - Intronic
1102914745 12:116744485-116744507 GCTGAGGCTCAGAGAGGGGAAGG + Intronic
1103204815 12:119120385-119120407 ACTGAGGCCCAGGAAGATGAAGG - Intronic
1103218184 12:119219879-119219901 ACTGAGGCTCAGAGATGTGAAGG + Intronic
1103607415 12:122097648-122097670 GCTCAGGCCCAGCTGTGTGAAGG + Intronic
1103721549 12:122978169-122978191 CCTGAGGCCCAGAGAGGGGAAGG - Intronic
1104636994 12:130443966-130443988 GCTGAGGCACAGCGAGGTGAAGG + Intronic
1106188532 13:27429098-27429120 ACAGAGGCCCACAAATGGGAGGG - Intronic
1106641264 13:31586851-31586873 GCTGTGGCACAGATAGGTGAAGG + Intergenic
1107164016 13:37264805-37264827 GATGATGCCCTGAAATGTGGTGG - Intergenic
1107307802 13:39040831-39040853 GCTGAGGCCCAGAAATCTTATGG - Intronic
1107552784 13:41492845-41492867 TCTGAGGCCCAGAGAGGGGAAGG - Intergenic
1108389366 13:49933209-49933231 ACTGTGGCCAAGAAATGTGGAGG - Intronic
1108582705 13:51840375-51840397 ACTGAGGGTCAGAAAAGTGAAGG + Intergenic
1111004256 13:82228364-82228386 GCTTAAGCCCAGAAGTTTGAGGG - Intergenic
1113243141 13:108362390-108362412 ACTGAGGCAGAGAAAGGTGAAGG - Intergenic
1114501202 14:23170158-23170180 ACTGAGGCTCAGAGAGGTGAAGG + Intronic
1114531714 14:23400610-23400632 GCTGTGGACCAGACATGGGAAGG - Intronic
1114536930 14:23428856-23428878 GCTGTGGACCAGACATGGGAAGG - Intronic
1114633233 14:24172781-24172803 GGTAAGGCCCAGAAAAGGGAAGG + Exonic
1114919084 14:27304068-27304090 GTTGAAGACCAGATATGTGAGGG + Intergenic
1115466070 14:33715648-33715670 ACTGAGGCCCAGACTTGTGATGG - Intronic
1115529987 14:34318181-34318203 TCAGAGGCCTAGAAAAGTGAGGG + Intronic
1116872558 14:50082191-50082213 GCTGAGCTCCAGACAAGTGAGGG - Intergenic
1117173705 14:53127364-53127386 GCTGAGGCTCAGAGAGGTTAAGG - Intronic
1118473412 14:66095162-66095184 GATGAGGCTGAGAAAAGTGAGGG + Intergenic
1118493151 14:66281370-66281392 ACTGAGGCCCAGAAACGACAAGG + Intergenic
1118918178 14:70125784-70125806 GATGAGGCCCAGACATGAGTGGG - Intronic
1119229000 14:72965494-72965516 GCAGAGGCCCAGATGTGTGGGGG - Intergenic
1119709973 14:76814540-76814562 ACAGAGGCCCAGCAATCTGAAGG + Intronic
1119938735 14:78617682-78617704 ACTGAGGCCCAGGAAAGTGAAGG - Intronic
1120638831 14:86984883-86984905 GCTGAGGACCAGACAGTTGATGG + Intergenic
1121214876 14:92240037-92240059 ACTGAGGCCCAGCAAAGTGATGG - Intergenic
1121322393 14:92999577-92999599 GCTGAGGCCCAGCAAGGAGGAGG - Intronic
1121607427 14:95251617-95251639 ACTGAGGCTCAGAAAGGTAAAGG + Intronic
1121643721 14:95503227-95503249 GGTGAGGCCCAGAGAAGTTAAGG - Intergenic
1121844404 14:97160260-97160282 ACTGAGGCTCAGAAAGGTGAAGG - Intergenic
1122145239 14:99684741-99684763 GCTGGGCCCCACAAACGTGATGG + Intronic
1122301151 14:100731862-100731884 GCTGAGGCTCAGGAAGCTGAAGG - Intronic
1122409162 14:101517311-101517333 GCTGAGACCCAGCAAGGTGAAGG - Intergenic
1122747148 14:103905056-103905078 GCCGAGGCCCAGAGAAGTTACGG + Intergenic
1122794106 14:104197130-104197152 GGTGAGGCCCAGAGAGGGGAAGG - Intergenic
1122856016 14:104560631-104560653 GCTGAGGCCAAGAAAGGGAAGGG + Intronic
1123122614 14:105924968-105924990 GCTGAGGCATAGAGAGGTGACGG + Intronic
1123405263 15:20016394-20016416 GCTGAGGCATAGAGAGGTGACGG + Intergenic
1123514592 15:21023042-21023064 GCTGAGGCATAGAGAGGTGACGG + Intergenic
1126738275 15:51752607-51752629 GCAGAGGCCCAGAGAGGTGGAGG - Intronic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1127982324 15:64044519-64044541 GCTGAGATCCAGAAAGGGGAAGG + Intronic
1128232608 15:66046142-66046164 ACTGAGGCTCAGAAAGGTGAAGG + Intronic
1128382386 15:67122556-67122578 ACTGAGGTCCAGAGAGGTGAGGG + Intronic
1128531116 15:68448691-68448713 GCTGAGGCTCAGATAGGGGAAGG - Intergenic
1129254843 15:74328409-74328431 TCTGAGGCTCAGAAAGGTGAAGG + Intronic
1129268549 15:74407765-74407787 GCTGAGGCCCAGAGAGGACAGGG + Intergenic
1129457665 15:75684220-75684242 GTTGAGGCCCAGACGTGGGATGG - Intronic
1129523549 15:76200401-76200423 ACTGAGGCCCAGAGAGGGGATGG + Intronic
1129669265 15:77598116-77598138 CCTGAGGCTCAGAAAGGTGAAGG + Intergenic
1129726136 15:77902739-77902761 GTTGAGGCCCAGACGTGGGATGG + Intergenic
1130274193 15:82468102-82468124 GTTGAGGCCCAGAGATGGGATGG + Intergenic
1130466538 15:84195476-84195498 GTTGAGGCCCAGACATGGGATGG + Intergenic
1130497726 15:84478060-84478082 GTTGAGGCCCAGACATGGGATGG - Intergenic
1130588835 15:85200069-85200091 GTTGAGGCCCAGAGATGGGATGG + Intergenic
1131310320 15:91284704-91284726 ACTGAGGCCCAGAGAAGTAAAGG - Intronic
1131721607 15:95174611-95174633 GCTGAGGCCCAGTCAGGTGTAGG - Intergenic
1131908389 15:97169207-97169229 GCTGAGGCCCAGAGAGGAGATGG + Intergenic
1133069257 16:3234980-3235002 GCAGAGGCCCCGAGAGGTGAGGG - Exonic
1133200423 16:4200797-4200819 CCTGAGGCCCAGAGACGTGCTGG - Intronic
1133291736 16:4726941-4726963 ACTCAGGCCCAGAAACCTGAGGG - Intronic
1133829924 16:9311899-9311921 CCTGAGGTTCAGAAAGGTGAAGG - Intergenic
1133905806 16:10021374-10021396 AATGACGCCCAGAAAGGTGAAGG + Intronic
1134220009 16:12346444-12346466 ACTGAGGCCCAGAGAGGTGGAGG + Intronic
1134662057 16:15991700-15991722 GGTGAGGACCAGCAAGGTGAAGG - Intronic
1135546394 16:23369834-23369856 ACTGAGGCACAGAGAAGTGAAGG - Intronic
1135768273 16:25196801-25196823 GCTGAGACCCAGAGAGGTAAAGG - Intergenic
1135867885 16:26121449-26121471 TCTGAGGCTCAGAATTGCGATGG + Intronic
1135956526 16:26960726-26960748 TGTGAGGCCCTGAAATGTGGAGG - Intergenic
1135983455 16:27166707-27166729 TCTGAGGCACAGACAGGTGAAGG + Intergenic
1137253748 16:46758684-46758706 TCTGACGCCCAGAGATGGGAAGG + Intronic
1137384668 16:48030326-48030348 GCTGAGGCCCAGAGAGGTGAAGG - Intergenic
1137405252 16:48184121-48184143 ACTGAGGCCCAGACAAGGGAAGG - Intronic
1137547164 16:49412137-49412159 GCTGATGCCCAGAGAAGGGAAGG + Intergenic
1137586724 16:49668292-49668314 ACTGAGGCCCCGAAATGGCAGGG + Intronic
1137726180 16:50658239-50658261 GCTGAGGCCCAGAGAGGGAAAGG - Intergenic
1137876580 16:52002424-52002446 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1137995026 16:53201041-53201063 GCTGAGGCCCAGATAAATGATGG + Intronic
1138272127 16:55702856-55702878 GCTGAGGTTCAGACATGAGAGGG - Intronic
1138699674 16:58849095-58849117 GGTGCAACCCAGAAATGTGAGGG - Intergenic
1138772697 16:59684944-59684966 GCTGAGACCCAGAAAAGTCAAGG + Intergenic
1140171847 16:72612897-72612919 ACTGAGGCCTATAAATGTAAAGG - Intergenic
1141026813 16:80556578-80556600 GCTGAGGACCAGAAAACTGCAGG - Intergenic
1141422591 16:83926375-83926397 ACTGAGGCCCAGAGAGCTGAAGG + Exonic
1141449651 16:84089662-84089684 GCTGAGGCTCAGAGAAGTGACGG + Intronic
1141463108 16:84189928-84189950 GATGAGGCCCAGGAGAGTGAAGG - Intergenic
1141886010 16:86892934-86892956 TCTGAGGCCCACAGAAGTGAGGG + Intergenic
1142236079 16:88923223-88923245 GCTGAGGCCCAGCAAGGCCAGGG - Intronic
1142560306 17:805477-805499 CCTGAGGCCCTGAAAGGCGAAGG - Intronic
1142862366 17:2770468-2770490 GCCGAGGCCAAAGAATGTGAGGG - Intergenic
1143002839 17:3805847-3805869 GCTGAGGCCCAGGGAGGTGAGGG + Intergenic
1143108359 17:4540588-4540610 GCTGAGGCCCAGGAAGGGGCAGG - Intronic
1143275760 17:5708784-5708806 GCTTAGGACCAGAAATGTTTTGG + Intergenic
1143852202 17:9821546-9821568 ACTGAGGCTCAGAGAGGTGAAGG + Intronic
1143921782 17:10336082-10336104 ACTGAGGCCCAGAGAGGTGAAGG + Intronic
1144762372 17:17714614-17714636 CCTGAGGCTCAGAAACGTAACGG + Intronic
1144942898 17:18953505-18953527 ACTGAGGCCCAGGAAGCTGAGGG - Intronic
1145078619 17:19875996-19876018 ACAGAGGCCCAGAGAGGTGAAGG - Intergenic
1145771134 17:27494070-27494092 GCAGAGGCCCAGAAATGCTTGGG + Intronic
1145993232 17:29091639-29091661 GCTGAGGAGCACAAATGTCATGG + Intronic
1146650316 17:34602366-34602388 ACTGAGGCCCAGAGAAGTGAAGG - Intronic
1146736671 17:35244031-35244053 GCTGACGCCCAGAAGTCTGGTGG - Intronic
1146915626 17:36676605-36676627 ACTGAGGCTCAGGAAGGTGAAGG + Intergenic
1147260369 17:39206598-39206620 GCTGAGGCCTAGAAAGGGAAGGG + Intergenic
1147364983 17:39953366-39953388 GCTGAGGACCAGACATGCGCCGG + Intergenic
1147401134 17:40180659-40180681 ACTGAGGCCCAGAGCTGGGAGGG - Intronic
1148049664 17:44763497-44763519 CCTGAGGCCCAGAGAAGTGAGGG + Intronic
1148147156 17:45373227-45373249 GGTGAGGCCCAGACAGGTCATGG + Intergenic
1148260751 17:46181107-46181129 GCTTAAATCCAGAAATGTGAAGG + Intronic
1148480069 17:47954237-47954259 ACTGAGGCCCAGAGAGGTGGTGG - Intronic
1148652322 17:49259199-49259221 ACTGAGGCCCAGAATGGGGAAGG + Intergenic
1149412024 17:56418671-56418693 ACTGAGACCCAGAAAGGTGAAGG + Intronic
1150165257 17:62935286-62935308 GTTGAAGCCCAGGAAGGTGAAGG - Intergenic
1150469740 17:65426791-65426813 CCTGAGCCCCATAAATGTTAGGG + Intergenic
1151273340 17:73013913-73013935 GCAGAGGCCCAGCGATTTGATGG + Intronic
1151326733 17:73384256-73384278 ACTGAGGCTCAGAGATGTTAAGG + Intronic
1151355456 17:73555468-73555490 GCTGAGGCCCAGGAAAGGAAGGG + Intronic
1151750212 17:76032847-76032869 GCTGTGGCCCAGGAATCTGCAGG + Intergenic
1151785880 17:76274823-76274845 ACTGAGGCACAGAGAGGTGAAGG - Intronic
1151894714 17:76972252-76972274 GCTGAGGCCCATTAATGGCATGG + Intergenic
1152376558 17:79921595-79921617 GCCGAGGCCCAGAGAGGTCAAGG - Intergenic
1153068916 18:1082126-1082148 GCCAAGGCACAGAACTGTGATGG + Intergenic
1154405246 18:14084635-14084657 GCTAAGGCTCGGAAATGGGAGGG - Intronic
1154406922 18:14101049-14101071 ACTGAAGCCCACAAATGTGAAGG + Intronic
1155327402 18:24678671-24678693 GCTGAGGTGAAGAAAAGTGAAGG + Intergenic
1155528923 18:26745776-26745798 GTAGAGTCCCAGAAATGTGTGGG + Intergenic
1156471067 18:37377547-37377569 CCTGAGGCTTAGAAATGAGAGGG + Intronic
1156529083 18:37797667-37797689 ACTGAGGCCCAGAGAAGTTATGG + Intergenic
1158055108 18:53269714-53269736 ACTGAGGCAAAGAAATGTTAAGG + Intronic
1159057185 18:63477623-63477645 GCTGAAACCCAGAAAACTGAAGG - Intronic
1159816366 18:73078711-73078733 GCTGTGGCCAAGGAAAGTGAAGG - Intergenic
1160006311 18:75071645-75071667 GCAGAGGCACGGAGATGTGAGGG - Intergenic
1160487200 18:79304374-79304396 GCTTAGGACCAGAAATATGTTGG + Intronic
1160768679 19:821053-821075 GCGGAGGCCCAGAGAGGTTAGGG + Intronic
1160874096 19:1289407-1289429 GCTGAGGGCCTGCAATGTGGGGG + Intronic
1161113034 19:2480188-2480210 ACTGAGGCACAGACAGGTGAAGG - Intergenic
1161623030 19:5309249-5309271 GCTGAAGCCCAGAGAGGTTAAGG - Intronic
1161646111 19:5454502-5454524 GCTGAGGCCCAGAGAGGCTAAGG + Intergenic
1161722452 19:5910714-5910736 ACAGAGGCCCAGAGGTGTGAAGG + Exonic
1161836697 19:6652531-6652553 ACTGAGGCCCAGAGATGCCAAGG + Intergenic
1162892332 19:13742878-13742900 GCTGATCCCCAGGAATGAGAGGG - Intronic
1162899380 19:13785490-13785512 GCTGAGACTCAGAAAGGTGAAGG - Intergenic
1162938670 19:13995133-13995155 GCTGAGGCTCAGAGAGGTTAAGG + Intronic
1163118537 19:15201934-15201956 GCTGAGGCCCAAAGCTGTGTGGG - Intergenic
1163460940 19:17437114-17437136 GCTGGGGCCCAGAGAGGTTAGGG + Intronic
1163527897 19:17832328-17832350 ACTGAGGCTCAGAAAAGTTAAGG + Intronic
1163560146 19:18014235-18014257 ACTGAGGCCCAGGACTGGGAGGG + Intergenic
1163595848 19:18220678-18220700 GCTGAGGCCCAGAGATCTCATGG - Intronic
1164551266 19:29214439-29214461 ACTGAGGCACAGAGAGGTGAGGG - Intergenic
1165314780 19:35048116-35048138 GCTGAGGCTCAGAGAGGGGAGGG + Intronic
1165900148 19:39165728-39165750 ACTGAGGCCCAGAGAAGGGAAGG - Intronic
1165914853 19:39251883-39251905 ACTGAGGCCCAGGAAAGTAAAGG + Intergenic
1165927108 19:39333738-39333760 ACTGAGGCCCAGAGGTGTTAAGG + Intronic
1165945744 19:39441200-39441222 ACTGAGGCCCAGAGAACTGAAGG + Intronic
1166225310 19:41391487-41391509 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166311071 19:41962942-41962964 ACTGAGGCCCAGAGACGGGAGGG - Intergenic
1166339408 19:42128667-42128689 GCTGAGGCCGAGCCATTTGATGG - Intronic
1166354630 19:42219631-42219653 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166359402 19:42246604-42246626 CCTGAGGCCCAGAAAGGGGAAGG - Intronic
1166516883 19:43453868-43453890 ACTGAGGCACAGAAAGATGATGG + Intergenic
1166855548 19:45781232-45781254 ACTGAGGGCCAGACATATGAGGG + Intronic
1167732343 19:51267686-51267708 GCTAAGGCCCAGAGAGGAGAAGG + Intronic
1168240179 19:55084979-55085001 GCTGAGGCACAGGGATGTAAAGG - Intronic
1168322940 19:55521252-55521274 GCTGAGGCACAGAGATGGGAAGG - Intergenic
1168637095 19:58004663-58004685 GCTGGGGTCCAGAAATGGGCAGG - Intronic
925760852 2:7183099-7183121 GCTGCGGCCCAGAACTGAGGGGG + Intergenic
925788677 2:7458698-7458720 TCTGAAGCACTGAAATGTGAAGG + Intergenic
926971788 2:18473982-18474004 GTTGAGGCTCAGAAATGTTTAGG - Intergenic
927026764 2:19076182-19076204 GCTGAGGCTCAGAAAAGGCAGGG - Intergenic
927030727 2:19118133-19118155 GCAAAGGCCCAGAACTGTGTTGG + Intergenic
927884402 2:26709790-26709812 CCTGAGGCCCAGCAAGGCGATGG + Intronic
928093672 2:28391645-28391667 ACTGAGGCCCAGAGAGGTTAAGG + Intergenic
928096163 2:28406479-28406501 ACGGAGACCCAGAAAGGTGAAGG + Intronic
929051515 2:37840971-37840993 GCTGAGGTTCAGAGAAGTGAAGG - Intergenic
930088478 2:47515109-47515131 GCTGTGCCCCAGCTATGTGATGG - Intronic
930574393 2:53127906-53127928 ACTGAGTCCCCGAAGTGTGAGGG - Intergenic
930645840 2:53905845-53905867 GCTCAGGACCAGAAATGTTTTGG + Intronic
931213474 2:60219747-60219769 GCAGAAGCCCAGAGAGGTGAAGG - Intergenic
932023553 2:68112398-68112420 GGAGAGGCCCAGAAGTGTGTCGG - Intergenic
932278441 2:70469215-70469237 GGTGAGGCCCAGAAATCTGTGGG + Intronic
932468500 2:71939122-71939144 GCTGAGCACCAGGAATGTGAGGG - Intergenic
932469269 2:71943300-71943322 GCTGTGGCCCAGCCACGTGAAGG - Intergenic
933781395 2:85804403-85804425 ACTGAGGCCCAGGGAGGTGATGG + Intergenic
933869910 2:86556209-86556231 GCTGAGGGTCAAAAATGGGAGGG - Intronic
934678027 2:96263728-96263750 GCTGTGGCTCAGAAAAATGAAGG - Intronic
935381022 2:102451325-102451347 GCAGAGTCCCAGAAATCAGAGGG - Intronic
935400856 2:102658600-102658622 GATGAGGGCCAGAAATGTGCTGG - Intronic
937483975 2:122294384-122294406 GCACAGGCCCAGAGATATGAAGG + Intergenic
937849348 2:126619128-126619150 GCTGAGGCTCAGAGAGGTGCTGG - Intergenic
938105859 2:128529341-128529363 GCTCAGGACCACAAATGTGATGG - Intergenic
939141747 2:138362286-138362308 GCTGAGGCCCAGATAGCTGAAGG + Intergenic
940232386 2:151470413-151470435 GCTTAGGACCAGAAATGTTTTGG + Intronic
940761443 2:157743038-157743060 GCTGATGTCCAGGTATGTGAAGG - Intronic
940850559 2:158684315-158684337 GCTGAGGCCCCCAAATGGGAGGG - Intergenic
941624615 2:167817711-167817733 GCTGAGTGACTGAAATGTGATGG - Intergenic
943676037 2:190717315-190717337 GCTGAGGCAAAGAAGTGTCAAGG + Intergenic
943729925 2:191291606-191291628 GCTGAGGTTCAGAAACGTGGAGG + Intronic
943754992 2:191548451-191548473 GCTGAGACCGAGAACTGTGATGG + Intergenic
945439624 2:209863913-209863935 GCTGAAGACCCGAAATGTCAGGG - Intronic
945685217 2:212960568-212960590 ACTGAGGATCAGAAATGTCAAGG - Intergenic
945979171 2:216295342-216295364 GCTTAAGCCCAGAAAGTTGAGGG - Intronic
946042124 2:216791636-216791658 ACTGAGGCCTAGAAAGGTAAAGG + Intergenic
946105189 2:217363065-217363087 GCTGAGGCTCAGAGAGGTTAAGG + Intronic
946144461 2:217718514-217718536 GTTGGGACCCAGAACTGTGAAGG - Intronic
946368638 2:219266719-219266741 GCTGTGGCCCCCAAATGTGCAGG + Intronic
947279283 2:228431151-228431173 GTAGAGACACAGAAATGTGATGG + Intergenic
948402864 2:237696622-237696644 ACTGAGGCTCAGAAAGGTCAGGG + Intronic
1168806140 20:673402-673424 GCTGAGGACCAGAGAAGGGAAGG + Intronic
1168860478 20:1042954-1042976 ACTGAGGCTCAGAGAGGTGAAGG + Intergenic
1168886800 20:1266005-1266027 GCTGAGGCCCAGAGAGGTGAAGG + Intronic
1168955293 20:1830268-1830290 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1169416412 20:5420622-5420644 GATGAGGCCCAGAGAAGTGAAGG + Intergenic
1170146938 20:13185911-13185933 GATGAGCCCAAGAAAAGTGATGG - Intergenic
1170877987 20:20268311-20268333 ACTGAAGCCCAGGGATGTGAGGG + Intronic
1171292514 20:23990358-23990380 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1171306679 20:24112776-24112798 ACTGAGGCCCAAAGAGGTGATGG + Intergenic
1171428621 20:25064478-25064500 ACTGAGGCCTAGAGATGTCAGGG - Intergenic
1171992217 20:31705393-31705415 ACTGAGGCTCAGAAATGGAAAGG + Intronic
1172038919 20:32030128-32030150 GCTGAGGCTCAGAAAGGCTAAGG + Intronic
1172122874 20:32608977-32608999 GCTGAGACCCAGTGATGTGAAGG + Intergenic
1172167322 20:32907220-32907242 ACTGAGGCTCAGAAAAGGGAAGG - Intronic
1172704919 20:36876079-36876101 GGTGAGGCCTAGAGATGAGAGGG - Intergenic
1172772022 20:37387439-37387461 ACTGAGGCTCAGCGATGTGAAGG + Intronic
1173006272 20:39142034-39142056 ACTGAGGCTCAGACATGTTAAGG - Intergenic
1173375013 20:42475219-42475241 CCTGAGGTCCAGAAATGTGCAGG + Intronic
1173478934 20:43384063-43384085 ACTGAGGCTCAGAGATGTGAAGG - Intergenic
1173569316 20:44066494-44066516 ACTGAGGCCCAGAAAGGGAAAGG + Intronic
1173595541 20:44256828-44256850 ACTGAGGCCCAGAAAGTTTAAGG + Intronic
1173657385 20:44709746-44709768 ACTGAGGTCCAGAGAAGTGAGGG + Intergenic
1173902106 20:46598445-46598467 ACTGAGGCCCAGAGAAGGGAAGG + Intronic
1173944729 20:46941415-46941437 ACTGAGCCCCAGAAAGATGAAGG - Intronic
1174359694 20:50020300-50020322 ACTGAGGCTCAGAGAAGTGATGG - Intergenic
1174417394 20:50376642-50376664 ACTGAGGCACAGAGAGGTGACGG - Intergenic
1174642509 20:52056732-52056754 GCTGAGGCCCAGGAATCTACAGG + Intronic
1175225152 20:57440243-57440265 GCTGAGGCCCAAAGATGAGAGGG - Intergenic
1175318082 20:58065823-58065845 ACTGAGGCCCAGAGAGGTTAAGG - Intergenic
1175488260 20:59361098-59361120 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
1175612500 20:60363523-60363545 ACTGAGGCACAGAGAGGTGAAGG + Intergenic
1175898554 20:62351004-62351026 GGTGAGGCCCAGGAATGTGCCGG + Intronic
1175920333 20:62447671-62447693 ACTGAGGCCCAGAGACTTGAAGG - Intergenic
1176150540 20:63588693-63588715 TCTGAGGCCCCGCAATGCGAGGG - Exonic
1176938898 21:14900093-14900115 GCTGTGGCCAGGAAATGGGATGG - Intergenic
1176979536 21:15364904-15364926 GCTTAGGACCAGAAATGTTTTGG + Intergenic
1177987379 21:27993765-27993787 CCTGAGCCCCACAAATGTTAGGG - Intergenic
1178378840 21:32091738-32091760 GCAGAGGCCTATTAATGTGAAGG + Intergenic
1178907035 21:36645163-36645185 GATGAGGCCCACACACGTGATGG - Intergenic
1179804244 21:43826882-43826904 GCTGAGGTCCAGGATTGGGAGGG + Intergenic
1180063058 21:45396165-45396187 GCTGAGCCTCACAAATGTCACGG - Intergenic
1180198387 21:46210655-46210677 GCTGAGGCTGAGAAAAGAGAAGG + Intronic
1180762587 22:18221268-18221290 CATGAGACCCAAAAATGTGATGG + Intergenic
1180773080 22:18403340-18403362 CATGAGACCCAAAAATGTGATGG - Intergenic
1180806315 22:18716521-18716543 CATGAGACCCAAAAATGTGATGG + Intergenic
1180823582 22:18848122-18848144 GCTGAGGCCCAGAAATGTGAAGG - Exonic
1181047337 22:20221829-20221851 GCTGAGGCCCAGAGAATTCATGG - Intergenic
1181124009 22:20691221-20691243 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1181189157 22:21126424-21126446 GCTGAGGCCCAGAAATGTGAAGG + Exonic
1181210042 22:21284071-21284093 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1181217261 22:21342302-21342324 CATGAGACCCAAAAATGTGATGG + Intergenic
1181399477 22:22642873-22642895 GCTGAGGCCCAGAAATGTGAAGG + Intergenic
1181576992 22:23801501-23801523 CCTGGGCCCCAGAACTGTGAGGG - Intronic
1181616980 22:24061560-24061582 GCTGAGGCTCAGTGATGAGAAGG - Intronic
1181649939 22:24253195-24253217 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1181707438 22:24657551-24657573 GCTGAGGCCCAGAAATGTGAAGG + Intergenic
1181853339 22:25765589-25765611 ACTGAGGCCAAGAAAGGGGAAGG - Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1181915354 22:26275543-26275565 GTTGAGGCCCAGAAATGACAAGG + Intronic
1182024592 22:27108133-27108155 GCTGAGGCCCAGAGAGGGAAGGG - Intergenic
1182043965 22:27259915-27259937 ACTGAGGCCCAGAGAAGGGAGGG - Intergenic
1182097915 22:27638402-27638424 GCTGAGGCCCAGAGAGGGGTTGG + Intergenic
1182124682 22:27807893-27807915 ACTGAGGCACAGAGAGGTGAAGG + Intergenic
1182281155 22:29218443-29218465 ACTGAGGCTCAGAGAGGTGATGG + Intronic
1182541412 22:31044685-31044707 ACTGAGGCTCAGAGAGGTGAAGG - Intergenic
1182735453 22:32529633-32529655 ACTGAGGCCCAGAGATGGGAGGG + Intronic
1182830932 22:33304086-33304108 GCAGAGACCCAGAAAGGGGAAGG - Intronic
1183210707 22:36449623-36449645 GCTGAGGCCCAGAGATGGGAAGG - Intergenic
1183236133 22:36619110-36619132 ACCGAGACCCAGAAAGGTGAAGG + Intronic
1183314543 22:37129613-37129635 ACTGAGGCCCAGAGAGGTGCAGG - Intronic
1183346901 22:37313029-37313051 ACTGAGGCCCAGAGATGGGAGGG + Intronic
1183347358 22:37315223-37315245 GCTGAGGACCAGAGAGGGGAAGG - Exonic
1183414753 22:37675829-37675851 ACTGAGGTCCAGAAAAGAGAAGG - Intronic
1183470029 22:38000291-38000313 GCTGAGGTCTAGAAAAGAGAGGG + Intronic
1183564186 22:38601412-38601434 GCTGAGGGGCAGAAATGAGGTGG + Intronic
1183735881 22:39644610-39644632 CCTGAACCCCAGAAAGGTGAGGG + Intronic
1184034656 22:41912749-41912771 CCTGAAGCCCAGAAAGGAGAAGG + Intronic
1184475995 22:44721747-44721769 GCCGAGGCCCAGACAGGGGAGGG + Intronic
1184668958 22:46002927-46002949 CCTGAGATCCAGGAATGTGAGGG - Intergenic
1184747650 22:46465393-46465415 ACTGAGGCCCAGGACTCTGAGGG - Intronic
1184794885 22:46726433-46726455 GCTGAGGCCCAGAAGTGGCACGG + Intronic
1203216905 22_KI270731v1_random:11362-11384 GCTGAGGCCCAGAAATGTGAAGG + Intergenic
1203234913 22_KI270731v1_random:144322-144344 CATGAGACCCAAAAATGTGATGG - Intergenic
1203273724 22_KI270734v1_random:74028-74050 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
949370149 3:3325845-3325867 ACTGAGGGCTAGAAATGAGAAGG + Intergenic
950121470 3:10484881-10484903 ACTGAGGCTCAGCACTGTGAAGG - Intronic
950195664 3:11007511-11007533 GCTGAGGCACAGAGAGGGGAAGG + Intronic
950399372 3:12758875-12758897 ACTGAGGCTCAGAAAGGTCAAGG + Intronic
950423528 3:12912403-12912425 ACTGAGGCTCAGAGATGTGAAGG + Intronic
950447795 3:13048150-13048172 ACTGAGGCACAGAGAGGTGAGGG - Intronic
950459610 3:13113381-13113403 GCTGAGGCCCAGAGAGGTCAAGG - Intergenic
950621692 3:14211071-14211093 ACTGAGGCACAGAGAGGTGAAGG - Intergenic
951224245 3:20102336-20102358 GCTTAGTTCCAGAACTGTGATGG + Intronic
951297551 3:20957564-20957586 TATGAGGCACAGAAATGTTAAGG - Intergenic
952117715 3:30202518-30202540 GCAGAGACCCTGAATTGTGAGGG - Intergenic
952180264 3:30909674-30909696 GCTGAGGGGCAAAAAAGTGAGGG + Intergenic
952981443 3:38739300-38739322 GCCAAGGCCCAGAAAGGAGAAGG + Intronic
953124658 3:40079010-40079032 GGTGAGGCCAAGTAACGTGATGG + Intronic
953125726 3:40090177-40090199 GATGAGGCCCAGAAAGATCAGGG - Intronic
953432553 3:42851753-42851775 ACTGAGGCCCAGAGATGGAAAGG - Intronic
953771559 3:45781812-45781834 GCTGAGGTCCAGAGAAGAGAAGG + Intronic
953876912 3:46671738-46671760 GCCAAGGCCCAGAAAAGGGAGGG - Intronic
953932677 3:47013525-47013547 GCAGAGGCCCAGAAAAGGGGTGG + Intergenic
954608897 3:51933922-51933944 GCTGAGGCCCTGACAAGTGAAGG - Intronic
954628306 3:52034880-52034902 CCTGAGTCCCAGAAAGGTGGAGG + Intergenic
954628863 3:52037582-52037604 ACTGAGGCCCAGAAAGGCCAGGG + Intergenic
954652239 3:52172174-52172196 ACTGAGGCCCAGAATTGCCATGG - Intergenic
954942309 3:54385334-54385356 GCTGAGGCTCAGACAGGGGAAGG + Intronic
955875728 3:63488531-63488553 GCTGAGGCCCAATAAGGTTATGG - Intronic
956823078 3:72971509-72971531 ACTGAGGCCCAGCAAGGTAAGGG - Intronic
960718574 3:120602951-120602973 GCTGAGGAGCAGAAATATAATGG + Intergenic
961086352 3:124070839-124070861 ACTGAGACCCAGAAAGGAGAAGG - Intergenic
961811663 3:129525463-129525485 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
961825549 3:129597337-129597359 ACTGAGGCCCATCAAGGTGATGG + Intronic
962014236 3:131424098-131424120 ACTGAGTCTCAGAAAAGTGAAGG + Intergenic
962030270 3:131592298-131592320 ACTGAGGCACAGAAAGATGAAGG + Intronic
962214273 3:133506911-133506933 ACTGGGGCTCAGAAAAGTGAAGG - Intergenic
962457589 3:135579262-135579284 GCTGAGGCCTGGAAAAGTTATGG + Intergenic
962852790 3:139320157-139320179 GCTGAGGCCCAGATTTCTGAGGG - Intronic
962967124 3:140365594-140365616 ACTAAGGCCCAGAGAGGTGAGGG + Intronic
963324390 3:143845618-143845640 GCTGAATCCCAGAGAAGTGAAGG - Intronic
963416415 3:145000915-145000937 GCTGTGGCCCCAAAATGTTAAGG + Intergenic
963515404 3:146301850-146301872 GGTGAGGCCCAGCACTGTGCTGG + Intergenic
963847484 3:150174068-150174090 ACTGAGGCCCAGTAAAGTGAAGG - Intergenic
964058570 3:152491982-152492004 GCTAAAACTCAGAAATGTGACGG + Intergenic
964213617 3:154255128-154255150 GCAGAGGCCCTGAAGTGAGAAGG - Intronic
966405743 3:179595722-179595744 GTTCATGCCAAGAAATGTGAAGG + Intronic
967377380 3:188819742-188819764 GCAGAGGGGCAGGAATGTGAAGG + Intronic
968927625 4:3558141-3558163 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
969199342 4:5590188-5590210 GCAGAGGCCCTGAACTGTCAGGG + Intronic
969286957 4:6208551-6208573 TCTGAGGCTCAGAGAGGTGAAGG - Intergenic
969502001 4:7558981-7559003 GCTGAGGCCCAGATAGGGGCAGG - Intronic
969615720 4:8251620-8251642 GCTGAGGCCCAAAGAGGGGAAGG + Intergenic
969646488 4:8432619-8432641 GCTGAGGCCCTGGAAGGTAATGG + Intronic
969656512 4:8501812-8501834 GCTGGGGCCCAGAAAGGACAGGG - Intergenic
969674615 4:8607933-8607955 ACTGAGGCCCGGAAAAGGGAGGG - Intronic
969690152 4:8699735-8699757 GCTGCTGCCCAGAAATGGAAGGG + Intergenic
969703432 4:8780031-8780053 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
970405748 4:15761633-15761655 GCTCAAGCACAGAAATGTGGTGG - Intergenic
971498261 4:27290867-27290889 ACTGAAGCTCAGAAATGTTAAGG + Intergenic
972004412 4:34081143-34081165 GCGGAGGCTCAGAAATGTTAAGG - Intergenic
973187181 4:47344100-47344122 GCTGAGAACCTGAAATTTGAAGG + Intronic
974220899 4:58969505-58969527 GATGAGGCTCAGAGAGGTGAAGG - Intergenic
975326514 4:73064593-73064615 TCTGAGGCCCAGAGAGGTTAAGG + Intronic
975377604 4:73663970-73663992 ACTGAGGCTCAGAGATGTCAAGG - Intergenic
975504007 4:75117948-75117970 GCTGAGACCCAGTACTGTGCTGG + Intergenic
975677108 4:76837868-76837890 ACTGAGGCACAGAAAAGTTAAGG + Intergenic
976153980 4:82122942-82122964 GCTGAGGGGCTGAAATGGGAAGG - Intergenic
978256700 4:106700795-106700817 ACTAAGGCTCAGAAATGTGAGGG - Intergenic
978340479 4:107717356-107717378 ACTGAGGCACAGAGATGTCATGG - Intronic
978579090 4:110214705-110214727 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
979491701 4:121335664-121335686 TTTCAGGCCTAGAAATGTGAAGG - Intronic
980132223 4:128827390-128827412 GCTGAGCCCCAGAAAAGTGGTGG + Intronic
980880009 4:138700502-138700524 ACTGAGGCCCAGAGAGGTGGTGG - Intergenic
982622871 4:157728421-157728443 GGTGAGACCCAGAGCTGTGATGG + Intergenic
982703702 4:158684768-158684790 ACTGAGACCCAGATATTTGAAGG + Intronic
987305248 5:16631521-16631543 GCTGAGGCCCACATATCTTACGG + Intergenic
987617462 5:20295262-20295284 GCTGGCTCCCAGAGATGTGAAGG - Intronic
987708285 5:21482111-21482133 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
987708459 5:21482927-21482949 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
988751152 5:34191218-34191240 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
988751328 5:34192028-34192050 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
988751496 5:34192844-34192866 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
989584153 5:43061475-43061497 GCTGATGCCCTGAAATGCCATGG - Intergenic
990519279 5:56562426-56562448 TGTGAGGCACAGAAATGTTATGG - Intronic
991669433 5:69033138-69033160 GATGAGGCCCAGAGATTTGAGGG - Intergenic
991736292 5:69633142-69633164 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991736459 5:69633949-69633971 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991736639 5:69634771-69634793 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991736811 5:69635587-69635609 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991758252 5:69899556-69899578 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991758426 5:69900372-69900394 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991758604 5:69901194-69901216 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991758774 5:69902001-69902023 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991812788 5:70488781-70488803 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991812960 5:70489588-70489610 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991813135 5:70490416-70490438 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991815747 5:70509258-70509280 GCTGAGGACAAGAAATGTGAGGG - Intergenic
991815914 5:70510065-70510087 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991816095 5:70510887-70510909 GCTGAGCCCAAGAAATGTGCGGG - Intergenic
991816267 5:70511697-70511719 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991837655 5:70775438-70775460 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991837833 5:70776260-70776282 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991838003 5:70777067-70777089 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
993174580 5:84467252-84467274 GTTGAGAACCAGAAATGTGAGGG + Intergenic
994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994486518 5:100390370-100390392 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994486686 5:100391189-100391211 GCTGAGGCCCAGAAACATGAGGG - Intergenic
994486855 5:100392008-100392030 GCTGAGGCCCAGAAATATGAGGG - Intergenic
995183042 5:109246718-109246740 GCGGAGGCCATGAAATGAGATGG + Intergenic
995608023 5:113879304-113879326 GTAGAGGCCCAGAAATGTGGAGG + Intergenic
995917814 5:117271032-117271054 GCTGAGCACCAAAAATGTAACGG - Intergenic
996406811 5:123113677-123113699 GCTGAGGCCCTGTAATTTAATGG - Intronic
996587314 5:125104435-125104457 GCTGATGCTCAAAAATGGGATGG - Intergenic
996929653 5:128870589-128870611 GCAGGGGCCCAGTAATGAGAGGG - Intronic
997301807 5:132811882-132811904 GCTGAGGCACAGAGAAGTCAAGG + Intergenic
997450542 5:133979195-133979217 GCTGAAGCTCAGATATGTGGGGG + Intronic
997782419 5:136673534-136673556 TAAGAGGCCCAGAAATGTAATGG - Intergenic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
998081637 5:139279844-139279866 GCAGAGCTCCAGAAAAGTGAGGG - Intronic
998374220 5:141680710-141680732 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
998395585 5:141815873-141815895 ACTGAGGCTCAGAGATGTTAAGG + Intergenic
998489572 5:142534528-142534550 GCTGAGGCCTGGAAAAGTGAAGG + Intergenic
998512126 5:142722374-142722396 TCTGAGGCCAAGAAATTGGATGG + Intergenic
999174572 5:149623002-149623024 GCTGTGGGCTAGAAAGGTGATGG - Intronic
999281316 5:150368069-150368091 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
999307557 5:150530036-150530058 GCTGAGGCTCAGGCATGGGAGGG - Intronic
999393836 5:151214017-151214039 GCTGAGGCCCAGAGGTGGGTGGG + Intronic
999411192 5:151351218-151351240 ACTGAGGCCCAGATAGGAGAAGG + Intergenic
999443423 5:151620324-151620346 GCTGAAGCCTAGAAATGGGGAGG + Intergenic
999483583 5:151971204-151971226 GCAAAGGCCCAGAAATAAGAGGG + Intergenic
999519365 5:152334799-152334821 GCTGAGGCCCAGAGAAAAGAAGG - Intergenic
999626821 5:153529860-153529882 GCAGAGGGCCTGAAATGAGAGGG - Intronic
999730242 5:154471767-154471789 GCTGAGGCGTAGAGAGGTGAAGG - Intergenic
999734929 5:154506005-154506027 ACAGAGGCCCAGAGAGGTGAAGG + Intergenic
1000176782 5:158763863-158763885 GCTGAGGCTCAGATAAGGGAAGG - Intronic
1000377824 5:160599883-160599905 GCTGAGGCACAGAGATGTGAAGG + Intronic
1000403005 5:160852240-160852262 GCCGAGTCCCAGAACAGTGAAGG + Intergenic
1001038788 5:168317115-168317137 GCTGTGGCCCAGAGAGGTTAGGG + Intronic
1001636210 5:173212104-173212126 ACTGAGGCTCAGAAAGGTGATGG - Intergenic
1001826126 5:174746474-174746496 ACTGAGGCCCAGATAGGGGAAGG + Intergenic
1003446906 6:6193135-6193157 GCAGAAACCCAGAAATGTGGAGG + Intronic
1004856763 6:19758864-19758886 GCTGAGCCTCAGAAATGAGCAGG - Intergenic
1004959877 6:20775422-20775444 ACTGAGGCCTAGCACTGTGATGG - Intronic
1005111901 6:22291370-22291392 ACTGAGGCTCAGAAAGGTTATGG - Intronic
1005549302 6:26897856-26897878 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1005549479 6:26898673-26898695 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1005549655 6:26899493-26899515 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1006373943 6:33661649-33661671 ACTGAGGCTCAGACATGTTAAGG + Intronic
1006934444 6:37707626-37707648 GGTAAGGCTCAGAGATGTGAAGG + Intergenic
1007843393 6:44734966-44734988 ACTGAGGCCCAGAGGTGAGAAGG + Intergenic
1008543774 6:52568073-52568095 GGTGAGCCCCAGAGAGGTGAAGG + Intronic
1009020042 6:57938966-57938988 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1011701603 6:89960287-89960309 GCCAAGGCCCAGAAAGGTGAAGG + Intronic
1012401091 6:98843442-98843464 GCTGAGGGCCCGGAAAGTGAGGG + Intergenic
1012996380 6:105979827-105979849 CCTGAGGCCCAGGACAGTGAAGG + Intergenic
1013137221 6:107294171-107294193 TCTGAGGCTGGGAAATGTGAAGG + Intronic
1014153846 6:118089221-118089243 GATGAGGGCCAGAATGGTGAGGG + Intronic
1014590581 6:123262697-123262719 AATGAGACACAGAAATGTGAAGG - Intronic
1014716670 6:124873294-124873316 ACTAAAGCCCAGAAATGTGGTGG - Intergenic
1015431117 6:133131364-133131386 GCTGAGGCCCATCAATATCATGG + Intergenic
1016761320 6:147740615-147740637 GCTGAATTCCAGAAAGGTGAAGG - Intergenic
1017174202 6:151487308-151487330 TCTGATGCACAGAAATTTGATGG + Intergenic
1019192773 6:170262899-170262921 GCTGAGGCCCAGAGAAGCCAAGG - Intergenic
1019301061 7:303781-303803 GCTGAGGCCCAGGAGAGTGTCGG + Intergenic
1019357718 7:589617-589639 GCTGAGGCCAAGAACTGAAACGG + Intronic
1019368409 7:647238-647260 GCTGAGGACCTGACATGGGAGGG - Intronic
1019475664 7:1242908-1242930 GCAGAGGCCCAGAGAGGGGAAGG + Intergenic
1019712173 7:2522732-2522754 ACTGAGGCCCAGAGAGGTGCAGG - Intronic
1020078658 7:5274950-5274972 AATGAGGCCCAGAGAGGTGAAGG - Intronic
1021375321 7:19899932-19899954 TCTGGGACCCAGAAAAGTGAGGG - Intergenic
1022478244 7:30726012-30726034 GCTGGAGCCCAGAGCTGTGAGGG + Intronic
1022478925 7:30730302-30730324 GCTGAGGCTCAGAAAGGTTAAGG - Intronic
1022510649 7:30933075-30933097 ACTGAGGCCGAGAAAGGAGAAGG - Intergenic
1023521525 7:41054641-41054663 GCTGAGGCACAGACAGGTCATGG + Intergenic
1023542093 7:41276431-41276453 GTAGAGGCCCAGATGTGTGAAGG - Intergenic
1023779955 7:43646453-43646475 ACTAATGCCCAGAAAGGTGACGG + Intronic
1023833410 7:44053589-44053611 GCTTAGGACCAGAAATGTTTTGG + Intronic
1024000479 7:45186207-45186229 ATTGAGGCTCAGAAATGTAAGGG + Intronic
1024696400 7:51860580-51860602 GCTGAGGCCCAGATGTCTGAAGG - Intergenic
1025200234 7:56957234-56957256 AATGAGGCCCAGAGAAGTGAAGG + Intergenic
1025253245 7:57365892-57365914 ACTGAGGCACAGAGAGGTGAGGG + Intergenic
1025603532 7:63022727-63022749 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
1025671711 7:63619698-63619720 AATGAGGCCCAGAGAAGTGAAGG - Intergenic
1026868760 7:73838296-73838318 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1027149611 7:75723570-75723592 GCTGAGACCCAGCAAGGAGACGG - Intronic
1028517249 7:91691573-91691595 ACTGAGGCACAGAGAAGTGAAGG + Intergenic
1028621351 7:92833001-92833023 CCTCAGGCCCAGAAAGGTGCGGG - Intronic
1029713992 7:102315914-102315936 ACTGAGGCACAGAGCTGTGAAGG - Intronic
1030085499 7:105812002-105812024 GCTGAGACCCAGAAAACAGAAGG - Intronic
1030130634 7:106196582-106196604 GTTGAGGCCCAGAGAGGTTAAGG + Intergenic
1030766511 7:113416699-113416721 GCTGGAGCCCAGAACTGTGGGGG + Intergenic
1032175274 7:129618744-129618766 GCTTAGGACCAGAAATGTTTTGG + Intronic
1032433258 7:131880112-131880134 GCTGAGGATCAGAGAAGTGATGG - Intergenic
1033454008 7:141486235-141486257 ACGGAGACCCAGAAAGGTGAGGG + Intergenic
1035247414 7:157572814-157572836 GCTGATGCCCAAAAATGGGCGGG + Intronic
1035323538 7:158050354-158050376 ACTGAGCCAAAGAAATGTGAAGG - Intronic
1035397525 7:158544967-158544989 GCTCCTGCCCAGAAATGGGAAGG + Intronic
1035764969 8:2098536-2098558 ACTGAGGCCCAGAGAGGCGACGG - Intronic
1036412227 8:8512804-8512826 GCTGTGGCCCATCACTGTGAAGG - Intergenic
1036659885 8:10701078-10701100 GCTGGGGCCCAGAGATGAAAGGG - Intronic
1036781680 8:11651980-11652002 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
1037583434 8:20260529-20260551 GGTGAGGCCCAGAGATGTTAGGG + Intronic
1037596632 8:20359734-20359756 CCTGAGGCACAGAAAGCTGAGGG + Intergenic
1037996979 8:23359852-23359874 GCAGAGGCACAGAGGTGTGAAGG - Intronic
1038355770 8:26827974-26827996 GCTGGAGCCCAGAAAGTTGAGGG - Intronic
1038483132 8:27915273-27915295 ACTCAGGCCCAGAAAGGTGCTGG + Intronic
1038869984 8:31483385-31483407 ACTGAGGCCCAGGAGAGTGAAGG + Intergenic
1041847859 8:62352229-62352251 GCTGAAGCTCAGCAATGGGAAGG - Intronic
1043154645 8:76763136-76763158 GCTGAGGCCCTGTTATGGGACGG - Intronic
1043526949 8:81107534-81107556 ACTGAGGCCTAGAAAAGTCAGGG - Intronic
1043587518 8:81786350-81786372 ACTGAGGCTCAGAAATGCAAAGG + Intergenic
1043919957 8:85970376-85970398 ACTGAGGCTCAGATAAGTGAAGG - Intergenic
1045051102 8:98326798-98326820 GCTGAAGCCCAGAATCATGAAGG + Intergenic
1045145583 8:99340511-99340533 GTTGTGCCCCATAAATGTGAAGG + Intronic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1047511646 8:125520427-125520449 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1048803811 8:138220480-138220502 ACTGAAGCCCAGAAAGGTCAAGG - Intronic
1049016360 8:139922831-139922853 GCTCAGGCCCAGAGAGCTGAAGG + Intronic
1049197922 8:141325629-141325651 GCTGAGGCCCAGGGACGTGAAGG + Intergenic
1049827776 8:144680923-144680945 GCTAACCCCCTGAAATGTGATGG - Intergenic
1050119069 9:2289364-2289386 GCTGATGCCCAGAGAGGCGAGGG - Intergenic
1053203638 9:36169021-36169043 ACTGAGGCCCAGAGAAGAGAAGG - Intergenic
1053728839 9:41031707-41031729 GCAAAGGCATAGAAATGTGAGGG + Intergenic
1053802481 9:41773220-41773242 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
1054142756 9:61541850-61541872 GCTGAGGCTCAGAGAGGTTAAGG - Intergenic
1054190790 9:61984566-61984588 GCTGAGGCTCAGAGAGGTTAAGG + Intergenic
1054462506 9:65473000-65473022 GCTGAGGCTCAGAGAGGTTAAGG - Intergenic
1054647584 9:67603151-67603173 GCTGAGGCTCAGAGAGGTTAAGG - Intergenic
1054699671 9:68400376-68400398 GCAAAGGCACAGAAATGTGAGGG - Intronic
1054813755 9:69455373-69455395 GCTGAGGCCCAGGATGGTGCGGG + Intronic
1057062276 9:92016376-92016398 GTTGAGGCACAGAGAGGTGAGGG - Intergenic
1057805963 9:98220222-98220244 GCTGAGGCTGAGAAAGGTTAAGG - Intronic
1057850102 9:98559022-98559044 ACCGAGGCCCAGAAAGGGGAAGG - Intronic
1057936392 9:99242931-99242953 AATGAGGACCAGAAAGGTGAAGG - Intergenic
1058680032 9:107432577-107432599 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1059391391 9:114001763-114001785 ACTGAGGCCCAGAGATGGGGGGG + Intronic
1059429078 9:114239431-114239453 GCTGAGGCCCAGAGAGGCTAAGG + Intronic
1059433255 9:114262265-114262287 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1059543273 9:115151733-115151755 ACTGAAGTCCAGAAATGGGAAGG + Intronic
1059705983 9:116823711-116823733 ACTGAGGATCAGAAAGGTGAGGG + Intronic
1059744179 9:117184126-117184148 GCTGAGGCCCAGGGTTGAGAAGG + Intronic
1059957667 9:119535093-119535115 GCAGAGACCCCGAAATGGGAAGG + Intergenic
1059964674 9:119601967-119601989 ACTGAGGCCCAGGAAGGGGAAGG - Intergenic
1060047413 9:120351686-120351708 GCTGAGGCCCAGAGAGTTTAAGG + Intergenic
1060103810 9:120861377-120861399 ACTGAGGTCCAGAGACGTGAAGG - Intronic
1060212082 9:121716726-121716748 CCTGAGGCCCAGGAATGTGATGG + Intronic
1060416020 9:123431363-123431385 ACTGAGGCCCAGAAACATTAAGG + Intronic
1060691591 9:125665706-125665728 GGTGAGGCCTAGAAATGTATAGG + Intronic
1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG + Intronic
1060943857 9:127558436-127558458 ACTGAGGCCCAGGAAGATGATGG - Intronic
1060969708 9:127731090-127731112 GCAGAGGCCCAGAAAGGTCAAGG + Exonic
1060978003 9:127776707-127776729 ACTGAGGCCCAGCAATGGGGAGG + Intronic
1060982552 9:127802306-127802328 GCTGAGGCCCAGAACTGGGGAGG - Intronic
1061141242 9:128768475-128768497 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1061151056 9:128828582-128828604 ACTGAGGCCCAGAGAAGGGAGGG - Intronic
1061238341 9:129354711-129354733 ACTGAGGCCCAGAGAGGTAAAGG - Intergenic
1061374711 9:130217110-130217132 ACTGAGGCTCAGACAGGTGAGGG + Intronic
1061382133 9:130265118-130265140 ACTGAGGCTCAGAGAGGTGAAGG - Intergenic
1061499451 9:130993642-130993664 CCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1061680306 9:132239759-132239781 GCTGAGGCCCAGGAACGGGAAGG - Intronic
1061765032 9:132876179-132876201 GCTGAGGCCCAGAGAAGGGAAGG - Intronic
1061798561 9:133102313-133102335 ACTGAGGCCCAAAAAGGTGAGGG + Intronic
1062025141 9:134336781-134336803 CCTCAGGTTCAGAAATGTGACGG + Intronic
1062178875 9:135179977-135179999 GCTGAGGCCCAGTGCTGGGATGG - Intergenic
1062231646 9:135485228-135485250 CATGAGACCCAAAAATGTGATGG + Exonic
1185626518 X:1486646-1486668 GCTGTTGCCCAGCACTGTGAAGG + Intronic
1186220443 X:7344167-7344189 GCTGAGCCCCTGAAATGTCAGGG - Intronic
1186669170 X:11752481-11752503 ACTAAGGCTCAGAAATGTTAAGG - Intergenic
1186792424 X:13011940-13011962 TCTGAGGCTCAGAAAGATGAAGG - Intergenic
1187238087 X:17487198-17487220 ACTGAGGCCCAGAGAGGTTAAGG + Intronic
1189128969 X:38478960-38478982 GCTGGGGCTGAGAAAGGTGAAGG + Intronic
1190433674 X:50402543-50402565 GGTGAGGGTCAGAAAAGTGAAGG - Intronic
1190589078 X:51979124-51979146 GCTGAGGCCTCAAAATGTAATGG - Intergenic
1191689237 X:63922809-63922831 GCTGAGGCTCAGCAATGGAAGGG + Intergenic
1191776786 X:64823144-64823166 ACTGAGGCCCAGAGAAGGGAAGG + Intergenic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1192145270 X:68678020-68678042 ACTGAGACCCAGAAAAGGGAAGG + Intronic
1192203272 X:69080770-69080792 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
1192204344 X:69086225-69086247 GATGAGGCCCAGAGAGGTGAAGG - Intergenic
1192226755 X:69233983-69234005 ACTGAGGCCCAGAAAGGGAAAGG - Intergenic
1192236629 X:69300334-69300356 ACTGAGGCCCAGAGCTGGGAAGG + Intergenic
1193058065 X:77175709-77175731 ACTGAAACCCAGAAATGGGAAGG - Intergenic
1193329865 X:80223781-80223803 GCTGAGCCCCAGTACTGTGCTGG - Intergenic
1194553421 X:95329838-95329860 GTTGAGACCCAGCAATGTGCTGG - Intergenic
1195852653 X:109299794-109299816 ACTGAGGCACAGAGAAGTGAAGG - Intergenic
1196933496 X:120705457-120705479 GCTGAGGCCAAGAATGGTTAGGG + Intergenic
1198133463 X:133723294-133723316 ACTGAGGCCCAGAAAAGGGCAGG + Intronic
1198985714 X:142450609-142450631 GCTGAGGGCCAGGAAGGGGAGGG - Intergenic
1199455923 X:148028609-148028631 GATGAGGCCCACTCATGTGAGGG + Intergenic
1199746635 X:150775925-150775947 GCTGGGGCCCTGGAAGGTGAAGG + Intronic
1199807273 X:151312751-151312773 ACTGAGGCCCAGAAAGGGTAAGG - Intergenic
1199858620 X:151780151-151780173 ACTGAGGCCCAGGAGTGAGAAGG + Intergenic
1200247374 X:154533334-154533356 GCTGAGGCCCAGAGAGGCAATGG + Intronic
1201372098 Y:13276785-13276807 GCTGATTCCCTTAAATGTGATGG - Intronic