ID: 1180824361

View in Genome Browser
Species Human (GRCh38)
Location 22:18852519-18852541
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 9, 1: 1, 2: 1, 3: 5, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180824361_1180824376 24 Left 1180824361 22:18852519-18852541 CCCCTCCTGGAGAACGCTGCGTT 0: 9
1: 1
2: 1
3: 5
4: 80
Right 1180824376 22:18852566-18852588 ACCACACAGGCTGTTGAGGCAGG 0: 10
1: 1
2: 0
3: 16
4: 565
1180824361_1180824365 -6 Left 1180824361 22:18852519-18852541 CCCCTCCTGGAGAACGCTGCGTT 0: 9
1: 1
2: 1
3: 5
4: 80
Right 1180824365 22:18852536-18852558 TGCGTTCCCCAGCCCCACACCGG 0: 9
1: 2
2: 1
3: 26
4: 212
1180824361_1180824372 11 Left 1180824361 22:18852519-18852541 CCCCTCCTGGAGAACGCTGCGTT 0: 9
1: 1
2: 1
3: 5
4: 80
Right 1180824372 22:18852553-18852575 CACCGGCTTTGCCACCACACAGG 0: 11
1: 0
2: 0
3: 4
4: 109
1180824361_1180824378 27 Left 1180824361 22:18852519-18852541 CCCCTCCTGGAGAACGCTGCGTT 0: 9
1: 1
2: 1
3: 5
4: 80
Right 1180824378 22:18852569-18852591 ACACAGGCTGTTGAGGCAGGAGG 0: 10
1: 1
2: 25
3: 539
4: 7324
1180824361_1180824374 20 Left 1180824361 22:18852519-18852541 CCCCTCCTGGAGAACGCTGCGTT 0: 9
1: 1
2: 1
3: 5
4: 80
Right 1180824374 22:18852562-18852584 TGCCACCACACAGGCTGTTGAGG 0: 10
1: 1
2: 0
3: 16
4: 158
1180824361_1180824379 30 Left 1180824361 22:18852519-18852541 CCCCTCCTGGAGAACGCTGCGTT 0: 9
1: 1
2: 1
3: 5
4: 80
Right 1180824379 22:18852572-18852594 CAGGCTGTTGAGGCAGGAGGCGG 0: 10
1: 1
2: 3
3: 101
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180824361 Original CRISPR AACGCAGCGTTCTCCAGGAG GGG (reversed) Intronic
900237486 1:1599737-1599759 ACCGCAGCGTCCTCCTGCAGTGG - Exonic
900808863 1:4786056-4786078 AAGGCAGGGTTCTCCAGGCATGG + Exonic
904434209 1:30483788-30483810 AACTCAGCTCTTTCCAGGAGAGG + Intergenic
907892707 1:58650712-58650734 AGGGCAGCCTACTCCAGGAGAGG - Intergenic
910398097 1:86811734-86811756 AAAGCAAAGTTCACCAGGAGAGG + Intergenic
919601038 1:199622357-199622379 AACTCAGTGATCTTCAGGAGAGG - Intergenic
920956765 1:210626664-210626686 AATCCAGAGTTCTCCAGGATGGG - Intronic
922191760 1:223324932-223324954 AATGCACCGTACTCCAGGAAGGG + Intronic
1063211594 10:3885919-3885941 AACGTGGCCTTCTGCAGGAGAGG - Intergenic
1069842252 10:71347160-71347182 AAGCCACGGTTCTCCAGGAGGGG - Intronic
1070660391 10:78301672-78301694 AAGGCAGGCTCCTCCAGGAGAGG - Intergenic
1070964777 10:80523188-80523210 AATGCAGCATCCTCCAGGAGGGG + Exonic
1071839350 10:89452908-89452930 GACGCAGCTTTCTGCAGGTGAGG + Intronic
1074995458 10:118754311-118754333 AGCGGAGCTTTCTCCAAGAGGGG + Intronic
1077544440 11:3163135-3163157 AGCTCAGGGTTCTCCCGGAGAGG - Intronic
1078944330 11:16046769-16046791 AATGCAGCTTTCTACAGGGGAGG - Intronic
1080962986 11:37181766-37181788 AAGGCAGGGTTCTGCTGGAGTGG - Intergenic
1083452371 11:62754435-62754457 AACGCGGCGCTCTCCTGGCGAGG + Intergenic
1085020145 11:73201556-73201578 AATGCAGCCTCCGCCAGGAGGGG - Intergenic
1088902072 11:114125903-114125925 AAAGCAGCCTTCTCCTGAAGAGG + Intronic
1092833617 12:12467919-12467941 AAGGCAGAGTTCTGCGGGAGTGG - Exonic
1097036541 12:56128319-56128341 AATGGAGCGATCTCCAGGAGAGG + Exonic
1097713049 12:62935374-62935396 AAGGCAGCATTCCTCAGGAGTGG - Intergenic
1100830726 12:98515069-98515091 AAAGAAGCGTTCGCGAGGAGAGG + Intergenic
1104351471 12:128047818-128047840 GAGGCAGCGTTCTGCAGGTGAGG - Intergenic
1109800377 13:67369887-67369909 AACTCAGCTTTTTACAGGAGAGG + Intergenic
1113787041 13:113007413-113007435 AACGCAGGGGTCTCAAGGTGAGG - Intronic
1116557991 14:46337430-46337452 AATGCATCATTATCCAGGAGTGG - Intergenic
1119902575 14:78273921-78273943 AAGGCAGAGTTCACCAGGTGGGG + Intronic
1126465559 15:48958440-48958462 AAGGCCGTGTTCTCCAGGTGAGG - Intronic
1132995018 16:2818281-2818303 ACCGCACCGTCCACCAGGAGGGG - Intronic
1139850376 16:69948625-69948647 AAGGCAGCTTTCCCCAGGTGAGG - Intergenic
1139879360 16:70171538-70171560 AAGGCAGCTTTCCCCAGGTGAGG - Intergenic
1140373164 16:74424011-74424033 AAGGCAGCTTTCCCCAGGTGAGG + Intergenic
1141207747 16:81946455-81946477 CACACAGCATTCTCCAGGAAAGG - Intronic
1145831794 17:27922182-27922204 AGTGCAGAGTTCTCCAGGAAGGG - Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1150209388 17:63433866-63433888 AAAGCAAGGTTCCCCAGGAGAGG - Exonic
1157783111 18:50457621-50457643 AACTCTGGGTCCTCCAGGAGAGG + Intergenic
1164692299 19:30220396-30220418 AAAGCAGGGTTCTCCATGGGAGG + Intergenic
1168703370 19:58454475-58454497 AAGGCAGCAGCCTCCAGGAGAGG - Intronic
928918167 2:36496694-36496716 AACACACATTTCTCCAGGAGAGG - Intronic
932648855 2:73533151-73533173 AGCACAGCTTGCTCCAGGAGAGG - Intronic
932779191 2:74549363-74549385 AACGCGGCCTTCTACAGGTGAGG - Exonic
948309243 2:236972680-236972702 AAGGCAGCGGTCTCCAGGGGAGG - Intergenic
1169494796 20:6104747-6104769 AACGAATCGTACTCCAGAAGGGG - Intronic
1171293300 20:23994804-23994826 AACGCAGCGTTCTCCAGGAGGGG - Intergenic
1174102799 20:48139952-48139974 AAGGCAGAGTTCCCCAGGGGTGG + Intergenic
1176018128 20:62948067-62948089 AACGCAACGTTCTCCATCAGCGG - Exonic
1177319732 21:19505824-19505846 TTTACAGCGTTCTCCAGGAGAGG - Intergenic
1180824361 22:18852519-18852541 AACGCAGCGTTCTCCAGGAGGGG - Intronic
1181124787 22:20695673-20695695 AACGCAGCGTTCTCCAGGAGGGG - Intergenic
1181188373 22:21122029-21122051 AACGCAGCGTTCTCCAGGAGGGG + Intergenic
1181210825 22:21288464-21288486 AACGCAGCGTTCTCCAGGAGGGG - Intergenic
1181398684 22:22638424-22638446 AACGCAGCGTTCTCCAGGAGGGG + Intergenic
1181501416 22:23317780-23317802 AACGCAGCGTTCTCCAGGAGGGG + Exonic
1181650737 22:24257635-24257657 AACGCAGCGTTCTCCAGGAGGGG - Intergenic
1181706645 22:24653104-24653126 AACGCAGCGTTCTCCAGGAGGGG + Intergenic
1181996732 22:26888756-26888778 CACGAAGCATTGTCCAGGAGAGG - Intergenic
1184022303 22:41828957-41828979 AAGACAGCGTTTTCCAGCAGCGG + Intergenic
1203216122 22_KI270731v1_random:6966-6988 AACACAGCATTCTCCAGGAGGGG + Intergenic
1203274499 22_KI270734v1_random:78423-78445 AACACAGCGTTCTCCAGGAGGGG - Intergenic
954095568 3:48324717-48324739 CATGCAGTGTTCTCCAGGATAGG - Intronic
960811703 3:121632691-121632713 AAGGCTGTGTTCCCCAGGAGAGG - Intronic
964394443 3:156230958-156230980 AAGGCAGTTTTCTCCAGAAGAGG - Intronic
964501019 3:157348146-157348168 AAGGCAGGGTTCTCCATGAACGG - Intronic
964537316 3:157737846-157737868 CACGCAGTGTTCTCTAGAAGAGG + Intergenic
970456178 4:16226413-16226435 ACCGCCGCCTTCTCCCGGAGCGG + Exonic
975732767 4:77353940-77353962 AATGCAGTGTTGGCCAGGAGAGG + Intronic
975734357 4:77367036-77367058 AATGCAGTGTTGGCCAGGAGAGG + Intronic
983939687 4:173526321-173526343 TACTCAGCGTTCTCCAGCTGGGG + Exonic
988168593 5:27626232-27626254 AACGCAGCTGTCTCTAGAAGCGG + Intergenic
1001159460 5:169300723-169300745 GAGGCAGCCTCCTCCAGGAGCGG - Exonic
1005726640 6:28655653-28655675 AAAGCAGGGATCTCAAGGAGTGG - Intergenic
1006033420 6:31194186-31194208 AAAGCAGAATTCTCCAGGGGTGG - Intergenic
1010606489 6:77895469-77895491 ATGGCAGCATTCTTCAGGAGAGG - Intronic
1022906146 7:34859479-34859501 AACACAGCATTCCTCAGGAGAGG + Intronic
1026102374 7:67393756-67393778 AATGCATTGTTCTCCTGGAGTGG + Intergenic
1034530403 7:151692950-151692972 AGCACAGCTGTCTCCAGGAGGGG - Intronic
1035074983 7:156171209-156171231 CACACAGCTCTCTCCAGGAGAGG - Intergenic
1035363167 7:158327743-158327765 AAGGCAGCCTCCACCAGGAGGGG - Intronic
1035635581 8:1141132-1141154 AAGGCAGCTTTCTCCTGGGGAGG + Intergenic
1039874928 8:41577634-41577656 CAAGCAGGGTGCTCCAGGAGTGG - Intronic
1049039248 8:140099828-140099850 TCCGCAGCCTTCTCCAGGGGAGG + Intronic
1049701061 8:144012883-144012905 AATGCAGCCTCCTCCAGGACAGG - Intronic
1054942750 9:70761289-70761311 GCTGAAGCGTTCTCCAGGAGGGG + Intronic
1055659993 9:78493370-78493392 TATGAAGCATTCTCCAGGAGAGG + Intergenic
1056998774 9:91488364-91488386 AACTCAGCCATGTCCAGGAGAGG + Intergenic
1061907249 9:133704996-133705018 AAGGCTGCGTGTTCCAGGAGCGG - Exonic
1062470409 9:136701005-136701027 AGCGCAGCTGTCTCCAGTAGGGG - Intergenic
1186202830 X:7171307-7171329 GACTCAGCGTTTTCCAGGAGGGG + Intergenic
1186669798 X:11757700-11757722 AGCGCTGCGTTCTCCAAGCGTGG + Intergenic
1190635232 X:52426497-52426519 GACACAATGTTCTCCAGGAGGGG + Intergenic
1190999669 X:55646642-55646664 AACACAATGTTCCCCAGGAGGGG - Intergenic
1196842504 X:119871586-119871608 AGAGCAGCTTTCTCCAGGAAAGG - Exonic
1200932667 Y:8711227-8711249 CACACAGCGTTTTTCAGGAGTGG - Intergenic