ID: 1180826695

View in Genome Browser
Species Human (GRCh38)
Location 22:18867796-18867818
Sequence CTCTGCAAGCAGCTGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180826683_1180826695 27 Left 1180826683 22:18867746-18867768 CCTCAATGCTCCTTCTCCAGGGA No data
Right 1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG No data
1180826688_1180826695 11 Left 1180826688 22:18867762-18867784 CCAGGGAGCCACGGGGCTTTCCT No data
Right 1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG No data
1180826690_1180826695 3 Left 1180826690 22:18867770-18867792 CCACGGGGCTTTCCTCCTCAGGA No data
Right 1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG No data
1180826692_1180826695 -9 Left 1180826692 22:18867782-18867804 CCTCCTCAGGAGGACTCTGCAAG No data
Right 1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG No data
1180826687_1180826695 17 Left 1180826687 22:18867756-18867778 CCTTCTCCAGGGAGCCACGGGGC No data
Right 1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG No data
1180826681_1180826695 28 Left 1180826681 22:18867745-18867767 CCCTCAATGCTCCTTCTCCAGGG No data
Right 1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180826695 Original CRISPR CTCTGCAAGCAGCTGGATGA AGG Intergenic
No off target data available for this crispr