ID: 1180827063

View in Genome Browser
Species Human (GRCh38)
Location 22:18870841-18870863
Sequence TCCCACCCTAGCTGAAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180827056_1180827063 13 Left 1180827056 22:18870805-18870827 CCAGGATAAGTCATTAGAGAGAG No data
Right 1180827063 22:18870841-18870863 TCCCACCCTAGCTGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180827063 Original CRISPR TCCCACCCTAGCTGAAGCCA TGG Intergenic
No off target data available for this crispr