ID: 1180827137

View in Genome Browser
Species Human (GRCh38)
Location 22:18871391-18871413
Sequence CACCCCAGTGTGCCTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180827131_1180827137 17 Left 1180827131 22:18871351-18871373 CCTCTGCATTGCAGTGGATCGTG No data
Right 1180827137 22:18871391-18871413 CACCCCAGTGTGCCTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180827137 Original CRISPR CACCCCAGTGTGCCTGGCAT GGG Intergenic
No off target data available for this crispr