ID: 1180831011

View in Genome Browser
Species Human (GRCh38)
Location 22:18906145-18906167
Sequence TGCAGCCACCACGGAGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 2, 1: 0, 2: 3, 3: 17, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180831003_1180831011 0 Left 1180831003 22:18906122-18906144 CCTCAGCTGAGCGAAACCCTCCT 0: 2
1: 0
2: 1
3: 9
4: 132
Right 1180831011 22:18906145-18906167 TGCAGCCACCACGGAGGGACGGG 0: 2
1: 0
2: 3
3: 17
4: 186
1180831001_1180831011 23 Left 1180831001 22:18906099-18906121 CCCGGGGAGCAGGAAGGTATGAG 0: 2
1: 0
2: 0
3: 28
4: 289
Right 1180831011 22:18906145-18906167 TGCAGCCACCACGGAGGGACGGG 0: 2
1: 0
2: 3
3: 17
4: 186
1180831002_1180831011 22 Left 1180831002 22:18906100-18906122 CCGGGGAGCAGGAAGGTATGAGC 0: 2
1: 0
2: 3
3: 23
4: 216
Right 1180831011 22:18906145-18906167 TGCAGCCACCACGGAGGGACGGG 0: 2
1: 0
2: 3
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180831011 Original CRISPR TGCAGCCACCACGGAGGGAC GGG Intronic
900030044 1:364702-364724 TGAGGCCAGCACGGTGGGACTGG + Intergenic
900050696 1:593766-593788 TGAGGCCAGCACGGTGGGACTGG + Intergenic
900284072 1:1890950-1890972 AGCAGCCGCCGCGGCGGGACTGG - Exonic
900331212 1:2135546-2135568 GGCAGCCACCACGCAGGGAAAGG - Intronic
900393531 1:2443923-2443945 TGCAGCCGCCACGGAGACAATGG + Intronic
905486313 1:38299223-38299245 TCCAGCCACCACTGAGTGACGGG - Intergenic
905864573 1:41369716-41369738 TGCAGTCAGCACCCAGGGACTGG + Intronic
910444271 1:87284572-87284594 TGCAGCCAGCACTGAGGAAATGG + Intergenic
911180903 1:94859468-94859490 TGCAGCCAACACACACGGACAGG - Intronic
912567160 1:110596069-110596091 GGCAGCCACCTGGGAGGGAAAGG + Intronic
915349017 1:155213108-155213130 GGCGGCCACCAGGGAAGGACAGG - Intronic
915352204 1:155233735-155233757 GGCGGCCACCAGGGAAGGACAGG - Intergenic
922674468 1:227542260-227542282 CGCAGCCGCCAGGGAGGTACCGG + Intergenic
922896783 1:229106904-229106926 AGCAGCCAACACCCAGGGACTGG - Intergenic
1062767491 10:76546-76568 AGCACCCACCCCGGAGGGGCCGG - Intergenic
1066428138 10:35327842-35327864 AGGAGCCACCATGGAGGGCCTGG - Intronic
1068827157 10:61453069-61453091 TCCGGCCAGCATGGAGGGACTGG - Exonic
1070828202 10:79403490-79403512 TGCAGGCTCCACGGAGGCCCCGG + Intronic
1076814894 10:132909793-132909815 TGGAGCCATCACGGATGGCCTGG - Intronic
1076859127 10:133131999-133132021 TGCATCCAACACGCAGGCACAGG - Intergenic
1077033798 11:483976-483998 TGCAGCCTGCATGGAGGGAGGGG + Intronic
1077221071 11:1416656-1416678 GGCAGCCACCACTGAGGCCCTGG + Intronic
1077249090 11:1552853-1552875 TGCAGCCCCCGAGGAGGGACTGG + Intergenic
1078922014 11:15839553-15839575 TGCAGGCAGCATGGAGAGACTGG + Intergenic
1081683108 11:45022682-45022704 TGCAGCCCGCATGGAGGAACTGG - Intergenic
1082691287 11:56308005-56308027 TGCTGCCCCCACTGAGGCACTGG - Intergenic
1083369173 11:62164894-62164916 TGCAGCCACTACTGCGGGAATGG + Intergenic
1083384908 11:62300457-62300479 TGCTGCCACCAAGGAGGGGGAGG + Intergenic
1083714641 11:64568408-64568430 TGCAGCCTCCACGGCCGGCCAGG + Intronic
1087960049 11:104337518-104337540 AGAAGCCACCAAGGAGGGAGAGG - Intergenic
1089720537 11:120415758-120415780 TGCAGACACCACAGATAGACAGG + Intronic
1091221831 11:133934326-133934348 TGCGTCCAGCACAGAGGGACGGG + Intronic
1091388377 12:109639-109661 TGCGGCCACTGAGGAGGGACAGG - Intronic
1096818596 12:54217069-54217091 TGAAGCCACCGAGGAGGGGCGGG + Intergenic
1102892205 12:116568671-116568693 TGCAGCCCCCATGATGGGACTGG + Intergenic
1104773841 12:131381158-131381180 AGCAGCCTCCACCGCGGGACTGG + Intergenic
1104786039 12:131448477-131448499 GGAAGACACCAGGGAGGGACAGG + Intergenic
1104913164 12:132250038-132250060 CCCAGCAGCCACGGAGGGACAGG + Intronic
1104967252 12:132513862-132513884 AGCAGCCCCCAGGGAGGGAGGGG + Intronic
1105843035 13:24272155-24272177 TGCAGCCAGCACGAACGGGCAGG + Intronic
1107773394 13:43812026-43812048 TGCAGCCTCCAGGGAGGCAGTGG - Intergenic
1108471166 13:50767889-50767911 TGCTGCCACCCTGGAGGGATTGG - Intronic
1110458081 13:75712279-75712301 TGCAGCCACCACGTAAAAACAGG - Intronic
1112425926 13:99301164-99301186 TGCTGCCCACACTGAGGGACAGG + Intronic
1112709688 13:102113341-102113363 TACACACACCACAGAGGGACAGG - Intronic
1113370688 13:109722409-109722431 TGGAGCCAACACGGAGGGGTGGG + Intergenic
1113618233 13:111695883-111695905 TGTAGCCACAAAGGAGGGAGAGG - Intergenic
1113623764 13:111781144-111781166 TGTAGCCACAAAGGAGGGAGAGG - Intergenic
1113681548 13:112248208-112248230 TGCAGCCAGGTGGGAGGGACAGG - Intergenic
1114031530 14:18584240-18584262 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1117197612 14:53356025-53356047 AGCAGGCACCATGGAAGGACGGG - Intergenic
1118393150 14:65313293-65313315 TACAAACACGACGGAGGGACTGG + Intergenic
1120883018 14:89429136-89429158 CGCAGCCAACACGGAGGTCCAGG - Intronic
1121177864 14:91904701-91904723 TGGAGCCCCCACGTTGGGACTGG - Intronic
1121555249 14:94831651-94831673 TGCACCCACCACAGTGGGAATGG + Intergenic
1122007283 14:98716027-98716049 TGCAGGCACTGTGGAGGGACCGG - Intronic
1122263521 14:100536309-100536331 CGCAGCAACCACGGAGGGTGTGG + Intergenic
1122531131 14:102427932-102427954 TGCATTCACCATGGAGGAACAGG + Intronic
1202853963 14_GL000225v1_random:38149-38171 AGCTGCCACCATGGAGGGCCTGG + Intergenic
1202857482 14_GL000225v1_random:59880-59902 AGCTGCCACCATGGAGGGCCTGG + Intergenic
1202857885 14_GL000225v1_random:63128-63150 AGCTGCCACCATGGAGGGCCTGG - Intergenic
1124098186 15:26669003-26669025 AGCTGCCATCACGGAGGGGCAGG - Intronic
1124355964 15:28994987-28995009 TGTAGCCAACATGGAGGGAGAGG + Intronic
1125509611 15:40285900-40285922 TCAATCCACCACGGAGGAACAGG - Intronic
1125828259 15:42693625-42693647 TGCCACCACCACTGAGGCACAGG + Exonic
1129247215 15:74286848-74286870 TGCTGCCACCACTGAGGGGAGGG + Intronic
1129890649 15:79069556-79069578 TCCAGCCAGGATGGAGGGACTGG + Intronic
1131056702 15:89379177-89379199 GGCAGCCGCGACGGAGGGTCCGG - Intergenic
1132080979 15:98865422-98865444 TGCAGCCGCCAAGGAGGGGCTGG + Intronic
1132663470 16:1071580-1071602 TGCAGCCTCCCCTGAGGGCCTGG + Intergenic
1132710613 16:1265509-1265531 TGCGGCCAGGAGGGAGGGACGGG - Intergenic
1133089702 16:3394617-3394639 TGCTGTTACTACGGAGGGACAGG - Intronic
1133705372 16:8349753-8349775 TGCAGCCACCAGTGAGTGGCAGG + Intergenic
1133985691 16:10666330-10666352 TCCAGGCACCACCGAGGAACAGG - Intronic
1134326575 16:13213135-13213157 TGCAGCCTCCAAGCAGGGACAGG - Intronic
1135330835 16:21558351-21558373 AGCAGCCACCACGACGGAACAGG + Intergenic
1137608589 16:49803801-49803823 TGCAGACACAAGGGAGGGGCAGG + Intronic
1138071360 16:53996059-53996081 AGCAGCCACCACGAGGTGACAGG + Intronic
1138630465 16:58290673-58290695 TACCGCCATCACGGAGGCACTGG - Intronic
1140584639 16:76275089-76275111 TGCAGCCATCAGGCAGAGACAGG + Intergenic
1141074509 16:80991263-80991285 TGCAGCCTACACGTAAGGACTGG - Intronic
1141503541 16:84460689-84460711 GGCAGCCACCACGGAGTGTGCGG + Exonic
1141601735 16:85130831-85130853 GGCAGCCAGGACGGAGGGGCGGG + Intergenic
1143098106 17:4489280-4489302 TGCAGCCAACAGGGAGGGCTGGG - Intergenic
1144778595 17:17796901-17796923 TGCTGCCACCCCGGAAGGGCCGG + Exonic
1145814171 17:27783578-27783600 CGGAGCTGCCACGGAGGGACTGG - Intronic
1146460019 17:33038956-33038978 TGCAGACACAAAGGAGGGAAGGG - Intronic
1147193440 17:38749809-38749831 TGCAGCCACACCAGCGGGACGGG + Exonic
1148978921 17:51554156-51554178 TGCTGCCACCACGATGGGAATGG + Intergenic
1149477864 17:56978184-56978206 AGCAGCAACCACCGCGGGACGGG - Exonic
1149685386 17:58531885-58531907 TGCAGCCGCCCGGGAGCGACCGG + Intronic
1150692323 17:67377329-67377351 TGCAGCCACCTCGCCGGGGCCGG - Intronic
1152504528 17:80739145-80739167 TGCCGCCACCACGGAGGCCGAGG + Intronic
1152702403 17:81825535-81825557 TGCAGCCCTCACAGAGGGCCAGG + Exonic
1152949713 17:83221858-83221880 TGAGGCCAGCACGGTGGGACTGG - Intergenic
1152960326 18:75892-75914 AGCACCCACCCCGGAGGGGCCGG - Intergenic
1153836512 18:8969048-8969070 TGGAGCCCACAAGGAGGGACTGG + Intergenic
1156485408 18:37462460-37462482 TGCATCCACCAGGGAAGGATTGG - Intronic
1156514579 18:37669318-37669340 AGCAGCTACCACGCAGGGACAGG + Intergenic
1160226630 18:77017014-77017036 TGCAGCCACCTCCGAGAGCCTGG - Exonic
1160420474 18:78740484-78740506 TGCAGCCTCCACTGTGGGTCAGG + Intergenic
1160838206 19:1134394-1134416 CGCAGTCACCACGGAGGAACAGG + Intronic
1161326690 19:3667648-3667670 GGCACCCACCACGGAGGGCCTGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162446304 19:10724956-10724978 TGCAGCACCCACTGAGGCACAGG - Intronic
1162635679 19:11965409-11965431 CGCAGTCACCGCGCAGGGACAGG - Intronic
1162654442 19:12117801-12117823 CGCAGTCACCAGGCAGGGACGGG - Intronic
1162672063 19:12266058-12266080 CGAAGTCACCACGCAGGGACAGG + Intronic
1165129222 19:33621861-33621883 AGCCGCCACCACGGCGGGGCGGG + Intergenic
1165901811 19:39172838-39172860 TGCATCCGACACGCAGGGACAGG - Intronic
1166130466 19:40742849-40742871 TGCACCCACCCTGGAGGGCCGGG - Intronic
1166219691 19:41356422-41356444 TGGTGCCACCACTGGGGGACTGG + Intronic
1166663534 19:44663022-44663044 TGCAGCCAGCAAGCTGGGACTGG + Exonic
1167667794 19:50832816-50832838 GGCAGACACCACTGAGGGTCAGG - Intronic
1167807735 19:51800185-51800207 TGCAGCAACCAAGGAGGCACTGG - Intronic
1167810966 19:51829817-51829839 TGCAGCAACCAAGGAGGCACTGG - Intergenic
1168598316 19:57696671-57696693 TGCAGCCTCCAAGTAGGGAATGG + Intronic
925132414 2:1503206-1503228 TGCAGCCTCCGCCGAGGGCCAGG - Intronic
925296363 2:2780073-2780095 TGAAGCCACCTGGGAGGTACAGG - Intergenic
925314080 2:2908024-2908046 TACAACCACCAAGGAGGGGCAGG - Intergenic
926246140 2:11123558-11123580 TGCAGCCTCACCGGAGGGCCAGG + Intergenic
926335449 2:11859281-11859303 TGCAGCAGCCACTGAGGGAGGGG + Intergenic
929258609 2:39839908-39839930 AGCAGCCACCAAGCTGGGACTGG - Intergenic
937293700 2:120797415-120797437 TGCAGCCACCACCAAAGGAGAGG - Exonic
938496666 2:131801553-131801575 CGCAGCCGCCAGGGAGGGACTGG + Exonic
939889779 2:147722771-147722793 TGGATCCACCACGGATGAACTGG - Intergenic
947421252 2:229943163-229943185 TGCAGCCAATGTGGAGGGACAGG + Intronic
948365413 2:237451634-237451656 TGCAGCGGCCACAGCGGGACTGG - Intergenic
1169113077 20:3045800-3045822 TCCAGCCCCCACGCAGGGAAGGG - Intergenic
1172948564 20:38706904-38706926 TGCAGCCAACAGGCAGGGAAAGG - Intergenic
1173384834 20:42577660-42577682 TTCGGCCACCACAGAGGGTCAGG + Intronic
1174130637 20:48341426-48341448 TGCAGACACCCAGGAGGGACTGG - Intergenic
1178385015 21:32142025-32142047 AGCAGCCACCTCAGAGGGAAGGG + Intergenic
1179615995 21:42583808-42583830 TGGAGCCGGCACTGAGGGACTGG - Intergenic
1180029926 21:45200118-45200140 AGCAGCCACCTTGGAGGGCCAGG + Intronic
1180067601 21:45420456-45420478 TGCAGCCCCCACGCAGGTAGTGG + Intronic
1180455642 22:15511297-15511319 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1180831011 22:18906145-18906167 TGCAGCCACCACGGAGGGACGGG + Intronic
1181003524 22:19998944-19998966 TGCAGCCACAACTCTGGGACAGG + Intronic
1181111531 22:20605642-20605664 TGCAGCAACCTCAGAGGGCCTGG - Intergenic
1181550015 22:23632486-23632508 TGCAGTCCCCACAGAGGGGCAGG - Intergenic
1181798371 22:25327050-25327072 TGCAGTCCCCATGGAGGGGCAGG + Intergenic
1182310595 22:29402856-29402878 TGCAGTCACCACAGAGGGACAGG + Intronic
1182351402 22:29702067-29702089 TGCAGACGCCAGGGAGGCACGGG + Intergenic
1182690455 22:32157890-32157912 TGCAGTCACCACAGAGGGACAGG - Intronic
1182690687 22:32159468-32159490 TGCAGTCACCACAGAGGGACAGG - Intergenic
1183909021 22:41064642-41064664 TGCAGCAGCCCAGGAGGGACAGG - Intergenic
1184144638 22:42602345-42602367 AGCTGCCACCACAGAGGGAAAGG - Intronic
1185097952 22:48821919-48821941 TGCTGGCCCCACGGAGGCACTGG + Intronic
1203281098 22_KI270734v1_random:131416-131438 TGCAGCCACCACGGAGGGACGGG + Intergenic
950125634 3:10508167-10508189 TGCATCCACCCCGCAGTGACTGG + Intronic
951258688 3:20481690-20481712 AGCAGCTGCCACTGAGGGACTGG + Intergenic
952027454 3:29100068-29100090 TGCAGCCAACAGGGAGGGGAAGG - Intergenic
952970167 3:38645692-38645714 TGCAGCCCTCACTGAGGGAAAGG + Intronic
954619694 3:51988512-51988534 TGCATCCACTTCTGAGGGACAGG - Exonic
961561686 3:127734546-127734568 TGCAGCCACTCTGGAGGGTCAGG - Intronic
962449251 3:135498254-135498276 TGCAGGCACCAGTTAGGGACAGG - Intergenic
966928339 3:184659875-184659897 TTCAGCCACCACGGAGGCCCCGG - Intronic
968441951 4:628711-628733 AGGAGCCACCATGGAGGGAGGGG + Intronic
968521478 4:1036522-1036544 TGCAGCGAGGATGGAGGGACAGG - Intergenic
968659607 4:1793631-1793653 TGCAGCAGCCAGGGAGGGAAGGG + Intronic
969170919 4:5362643-5362665 GACAGCCACCACGGAGGCAGGGG + Intronic
970400486 4:15712689-15712711 TGCAGCCACCATGGAGGATTTGG - Intronic
972424647 4:38920934-38920956 TGCAGCCAGCACTGAGGCTCTGG - Intronic
985640678 5:1062152-1062174 TTCTGGCACCACGGAGGGGCTGG + Intronic
986645263 5:9910744-9910766 TACAGACACCACAGAGGAACAGG - Intergenic
988994024 5:36697374-36697396 TGCAGCCACAAAGGCAGGACTGG - Intergenic
1000654310 5:163857813-163857835 TGCAGGCACCACTGGGAGACAGG + Intergenic
1002743945 5:181455670-181455692 TGAGGCCAGCACGGTGGGACTGG - Intergenic
1002931212 6:1636600-1636622 TGCGGCCCCCATGGAGGAACGGG + Intronic
1003240895 6:4344760-4344782 TGCTGCCCCCACGGAGGAAGAGG - Intergenic
1005403171 6:25456340-25456362 TTCAGCAACAACAGAGGGACTGG - Intronic
1006874016 6:37279782-37279804 GGCAGCCACCACTGTGGGAGGGG - Intronic
1007401004 6:41602279-41602301 GGCAGCCTCCACGGAGGGCTGGG - Exonic
1010938501 6:81888309-81888331 TGCTGCCACCACTGAGGGTGGGG + Intergenic
1014518750 6:122412256-122412278 TGAAGACATCAAGGAGGGACTGG + Intronic
1015716900 6:136202290-136202312 TGCTGCCACCACTCAAGGACCGG - Intergenic
1017012107 6:150069901-150069923 TGCAGTCACCATCCAGGGACAGG - Intergenic
1017998438 6:159555818-159555840 TGCAGCCTCCTCAGAGGCACGGG + Intergenic
1019248804 6:170728899-170728921 TGAGGCCAGCACGGTGGGACTGG - Intergenic
1019448489 7:1083764-1083786 TGCAGACACCAAACAGGGACAGG + Intronic
1025247557 7:57328683-57328705 TGCGGCCACTACAGTGGGACTGG - Intergenic
1033742351 7:144284741-144284763 TGTCTCCACCACGGAGGGATGGG + Intergenic
1033751551 7:144364873-144364895 TGTCTCCACCACGGAGGGATGGG - Exonic
1035355362 7:158273372-158273394 TGCATCCACGACGCTGGGACAGG - Intronic
1035499241 8:78436-78458 TGAGGCCAGCACGGTGGGACTGG + Intronic
1036671466 8:10791340-10791362 TGCTTCCACCGAGGAGGGACGGG - Intronic
1038011724 8:23481398-23481420 TGCAGGCACAACAGAGGGCCTGG + Intergenic
1039780432 8:40779750-40779772 GGCAGCCACCAGGGAGAGATGGG - Intronic
1041382077 8:57260986-57261008 TGCAGCCACCAGGATGGGACTGG - Intergenic
1047133522 8:122050178-122050200 TGCAGCCTCTACAGAGGGAGTGG + Intergenic
1047757349 8:127928751-127928773 TGCAGCCACCGCAGCAGGACAGG - Intergenic
1049254598 8:141606923-141606945 TGCAACCACCTCAGAGGGCCTGG + Intergenic
1049386316 8:142344747-142344769 TGCAGCCACCACAGAGGTGCAGG + Intronic
1049423539 8:142527191-142527213 TGCACCCACCTTTGAGGGACAGG + Intronic
1052758539 9:32566621-32566643 TGCACCCACCATGGAGGAGCAGG + Intronic
1053480256 9:38411483-38411505 TGCAGCCAACATGGTGGGAGAGG - Exonic
1054842927 9:69762001-69762023 TGTAGCCAGCAAGGTGGGACAGG + Intergenic
1057444251 9:95102930-95102952 TGCAGCCAGCACGGGGGCTCCGG + Intronic
1059282305 9:113145425-113145447 TGCAGCCACCAATTAGGGATTGG - Intergenic
1061202118 9:129143866-129143888 AGCAGCCCCCACTGTGGGACAGG - Intronic
1061233587 9:129329076-129329098 TGCAGCAACCACGAAGGGGTGGG + Intergenic
1061929548 9:133825301-133825323 TCGGGCCACCAGGGAGGGACGGG + Intronic
1062091575 9:134681194-134681216 TCGAGCCACCAGGGAGGGTCTGG - Intronic
1062568828 9:137175207-137175229 TGCAGGCCCCACGGGGGGCCAGG - Intronic
1062737771 9:138147812-138147834 AGCACCCACCCCGGAGGGGCCGG + Intergenic
1062738172 9:138150190-138150212 AGCACCCACCCCGGAGGGGCCGG + Intergenic
1203609760 Un_KI270748v1:86163-86185 TGAGGCCAGCACGGTGGGACTGG - Intergenic