ID: 1180831093

View in Genome Browser
Species Human (GRCh38)
Location 22:18906486-18906508
Sequence TACGCGGGCGGGGCGGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 2, 1: 1, 2: 2, 3: 62, 4: 543}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180831078_1180831093 23 Left 1180831078 22:18906440-18906462 CCAGCTGCTGTCGGCGTTACAGA 0: 2
1: 0
2: 1
3: 3
4: 47
Right 1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG 0: 2
1: 1
2: 2
3: 62
4: 543
1180831082_1180831093 -1 Left 1180831082 22:18906464-18906486 CCTGGTGAAGGAGTTGCCCAGGT 0: 3
1: 0
2: 1
3: 21
4: 156
Right 1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG 0: 2
1: 1
2: 2
3: 62
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180831093 Original CRISPR TACGCGGGCGGGGCGGGCGG CGG Intronic
900284265 1:1891501-1891523 TCCGGGGACGGGGCGGGTGGGGG + Intergenic
900663085 1:3795827-3795849 TGCCCGGGCGGGGCGGGATGGGG - Intronic
901016620 1:6235671-6235693 GGGGCCGGCGGGGCGGGCGGCGG - Intronic
901022213 1:6261152-6261174 GGCGGGGGCGGGGCGGGCCGAGG - Intergenic
901066595 1:6497338-6497360 GCCGCGCGGGGGGCGGGCGGCGG + Intronic
901373248 1:8818019-8818041 TACTGGAGCGCGGCGGGCGGCGG - Intergenic
901428603 1:9198938-9198960 CAGGCGGGCGGGGAGGGCGGGGG + Intergenic
902330723 1:15730042-15730064 TACCTGGGCGGGGCGGGGCGGGG + Intronic
902336829 1:15758850-15758872 TAAGCGGGCCGGGTGGGTGGGGG + Intronic
902920723 1:19664941-19664963 GCCGCGGGCCGGGCGGGCGGCGG - Intergenic
903044291 1:20553889-20553911 TGCGCGGGCGGCGGGGGCGCCGG - Exonic
903455502 1:23484249-23484271 GTCGGGGGCGGGGCGTGCGGAGG - Intronic
903828643 1:26161949-26161971 AGCCCGGGCGGCGCGGGCGGCGG + Exonic
904505803 1:30952670-30952692 AAAGCGGGGGGGGCGGGGGGGGG + Intronic
904751121 1:32741928-32741950 GGCGGGGGCGGAGCGGGCGGCGG - Exonic
905066839 1:35192077-35192099 TGCGGGGGCGGGGCGGCCTGCGG - Intronic
905275299 1:36813745-36813767 AGCGGGGGCGGGGCGGGGGGTGG + Intronic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
905647200 1:39633020-39633042 CCCGGGGGCGGGGCGGGCGAGGG + Intronic
905734750 1:40317284-40317306 TTCGCGGGCAGGGTGGGCTGGGG + Exonic
906615837 1:47232253-47232275 GGCGGGCGCGGGGCGGGCGGGGG - Intergenic
907051091 1:51330388-51330410 GGCGCGGGCGGCGCGGGCTGGGG - Intronic
907118586 1:51990218-51990240 AACGGGGGCGTGGGGGGCGGGGG - Intronic
907188991 1:52633261-52633283 GGGGCAGGCGGGGCGGGCGGCGG - Intergenic
907430240 1:54406953-54406975 CCCGGGGGCGGGGCGGGCTGGGG - Intronic
908850715 1:68373332-68373354 CCCGCAGGCGGTGCGGGCGGGGG - Intergenic
909957764 1:81800978-81801000 TCCGCCGGCGGGGCGGCCGCAGG - Intronic
910549745 1:88462767-88462789 GGCGCGGGCGGGCCGGGCGGAGG - Intergenic
912354333 1:109042327-109042349 AGCCTGGGCGGGGCGGGCGGGGG + Intergenic
912436806 1:109667988-109668010 TTCGGGGGCAGGGCGGGCCGTGG + Intronic
913129750 1:115828772-115828794 GACGGGCGCGGGGTGGGCGGGGG - Intergenic
913959287 1:143326844-143326866 GACGCGGGCGGGCGGGCCGGTGG - Intergenic
914869048 1:151458605-151458627 TGCGGCGGAGGGGCGGGCGGCGG - Intronic
915477354 1:156161031-156161053 TCCGCGGCCTGGGCGGGGGGCGG + Intronic
915852700 1:159343048-159343070 TGTGGGGGGGGGGCGGGCGGAGG + Intergenic
916051374 1:161039002-161039024 TGCGGGGGCGGCGCGGGAGGCGG - Intergenic
916651667 1:166839612-166839634 CGCGCGGGCGGGGGCGGCGGCGG + Intronic
917345262 1:174022432-174022454 TCAGGAGGCGGGGCGGGCGGAGG + Intergenic
917817641 1:178725982-178726004 TCCGGGGCCGGGGCTGGCGGGGG - Intronic
918064409 1:181089560-181089582 TGCGCGGCGGGGGTGGGCGGCGG + Exonic
918066565 1:181105491-181105513 TCAGCGGGCGGGGCGGGGCGGGG + Intergenic
919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG + Exonic
919809423 1:201399409-201399431 AGCGCGGCCGGGGCGCGCGGGGG - Exonic
919920855 1:202165733-202165755 AAGGCGGGGGCGGCGGGCGGGGG - Intergenic
922758422 1:228109436-228109458 TAGGTGGGCGGGGCCTGCGGGGG + Intergenic
922775568 1:228212979-228213001 AAAGGGGGCGGGGCGGGCAGGGG - Intronic
923132869 1:231092443-231092465 TATGGGGGTGGGGGGGGCGGTGG + Intergenic
1062774584 10:135154-135176 TGCGGGGCCGGAGCGGGCGGCGG - Intronic
1062795824 10:344386-344408 GGCGGGGGCGGGGCGGGGGGGGG + Intronic
1062843814 10:689789-689811 AGCGCGCGCGGGGCGGGCCGGGG - Intergenic
1063115538 10:3068977-3068999 TGAGCGCGCGGGGCGGGCGCGGG + Intronic
1064418232 10:15168721-15168743 GGCGCGGGCGGGGCGGGGCGGGG - Intergenic
1066023085 10:31320860-31320882 TACCGGGGCGGCGCAGGCGGGGG - Intronic
1066464400 10:35640333-35640355 GGCGCGGGCGCGGCGGGCGCGGG - Exonic
1066681070 10:37937467-37937489 TTCTGGGGCGGGGCGGGGGGTGG - Intergenic
1067474425 10:46556621-46556643 TCCGCGGGCCGGGCCGACGGCGG - Intergenic
1067669646 10:48307061-48307083 CAGGCGGGCGGGGCTCGCGGCGG - Intronic
1070327958 10:75400241-75400263 GGCGCGGGCGGTGCCGGCGGCGG - Exonic
1070781137 10:79138053-79138075 TCAGCGGGAGGGGCAGGCGGCGG + Intronic
1072151715 10:92689777-92689799 TTGGCCGGCGGGGCGGGCCGGGG + Intergenic
1072190108 10:93071684-93071706 TAGGGGGGCAGGGCGGGGGGTGG - Intergenic
1073076141 10:100826854-100826876 GTGGCGGGCGGGCCGGGCGGAGG - Intronic
1073188900 10:101635911-101635933 TACCCTGGGGGGGCGGGCGGAGG + Intronic
1073812347 10:107164641-107164663 GCCGCGGTGGGGGCGGGCGGAGG + Intergenic
1075037350 10:119080524-119080546 TCCCCGCGCGGGCCGGGCGGCGG + Intronic
1075129579 10:119726362-119726384 GAGGCTGGCGGTGCGGGCGGGGG + Intronic
1075699794 10:124461929-124461951 TACGACAGCGGCGCGGGCGGCGG + Exonic
1075999651 10:126905122-126905144 TAGGGGGGCGGGACGGACGGGGG - Intergenic
1076650209 10:131982117-131982139 GACGCGGGCGGGGAGAGGGGCGG + Intergenic
1076750094 10:132538072-132538094 TGCCCGGGCGGCGCGGGCGCTGG - Exonic
1076792752 10:132785728-132785750 CCCGTGGGCGCGGCGGGCGGGGG - Exonic
1076799265 10:132813145-132813167 TACTCGGGCGGGGCTCGCTGCGG + Intronic
1076868825 10:133182813-133182835 TGCGCGGGCGGCGAGGGCGCGGG + Intronic
1076900912 10:133336920-133336942 TTCGCGGCCGGGCGGGGCGGGGG + Intronic
1077008540 11:370031-370053 GGCGCGGGCGGCGCGGGCGGCGG + Intronic
1077067062 11:646356-646378 GGCCCGGGAGGGGCGGGCGGTGG - Intronic
1077097474 11:805143-805165 TGGGCGGGCGGAGGGGGCGGCGG - Intronic
1078246136 11:9574234-9574256 GGCGCGGACGAGGCGGGCGGTGG + Exonic
1078699726 11:13668929-13668951 TACCCGGGCGGGGGCGGGGGCGG - Intronic
1079406973 11:20156302-20156324 TGCGCGGGCGAGGGGGGCAGCGG + Exonic
1081611442 11:44565547-44565569 CTCGGGGGCGGGGCCGGCGGAGG + Intronic
1081770792 11:45649667-45649689 GACCCGGGCGGTGCGGGTGGGGG - Exonic
1082789247 11:57335786-57335808 GACGCGGGGGGGGCGCGGGGAGG + Exonic
1082816889 11:57515000-57515022 AACGCGGGCGGCGCGGGGGCGGG + Intronic
1083272982 11:61581278-61581300 GAGGCGGGCGGGGCGCGGGGCGG - Intergenic
1083553261 11:63606760-63606782 TAGGCGTGCGGGGAGGGCAGAGG + Intronic
1083572555 11:63768365-63768387 GACGCGGGCAGGGCGGCCGGGGG - Intronic
1083648428 11:64186336-64186358 TAGGGGGGCGGGGCGGGCGCCGG + Intronic
1083657043 11:64234722-64234744 GGCCCGGGCGCGGCGGGCGGGGG - Exonic
1083879283 11:65540197-65540219 TACGCGGGAGGGGCGGGGCCCGG - Intronic
1083939987 11:65890624-65890646 TACCCGGGCTGGGCACGCGGCGG - Exonic
1084070081 11:66728186-66728208 GGCGGGGGCGCGGCGGGCGGGGG + Intronic
1084070122 11:66728320-66728342 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1084151342 11:67289289-67289311 AGGGAGGGCGGGGCGGGCGGCGG - Exonic
1084151460 11:67289624-67289646 TGAGCGGGCGGGGGGGGGGGGGG - Intronic
1084187541 11:67482877-67482899 TCCGCGGGCCGGGCGGGACGAGG - Intergenic
1084265611 11:68003868-68003890 GGCGGGGGCGGGGCGGGCCGGGG - Intronic
1084333997 11:68446445-68446467 TCCGTGGCCGGGGAGGGCGGCGG - Exonic
1084546651 11:69818188-69818210 GCCGCGAGCGGGGAGGGCGGAGG + Intronic
1085050502 11:73377684-73377706 TGCGCGGGGGAGGGGGGCGGGGG - Intronic
1085094371 11:73747437-73747459 GCCGGGGGCGGGGCGGGGGGGGG - Intronic
1085165820 11:74398461-74398483 GCCGTAGGCGGGGCGGGCGGCGG - Exonic
1085266795 11:75242142-75242164 CCCGCGGGCGCGGCGGGCGCGGG - Exonic
1085561140 11:77473760-77473782 GACGCGGGCGGGGGGGGAAGGGG + Exonic
1088685320 11:112280139-112280161 GGCGTGGGCGGGGCGGGTGGGGG + Intergenic
1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG + Exonic
1089262559 11:117232703-117232725 TGAGCGGGCGGAGCGGGGGGAGG - Exonic
1089374750 11:117986364-117986386 GGCGCTGGCGGAGCGGGCGGCGG + Exonic
1089497159 11:118913677-118913699 TGGGCGGGTGGGGTGGGCGGGGG - Intronic
1089520044 11:119057248-119057270 TACGCGCGCCGGGGCGGCGGGGG - Intergenic
1090664544 11:128905744-128905766 TGGGGGGGCGGGGCGGGGGGAGG + Intronic
1091857730 12:3752969-3752991 TGGGCGGCCGGGGCGGCCGGGGG - Intronic
1091973909 12:4810062-4810084 TACGCTGGCGGCGCCGGGGGAGG + Exonic
1092256212 12:6928006-6928028 TAGGCGGGCGCGGGCGGCGGCGG + Intronic
1093212542 12:16325142-16325164 TACTCGGGCGGGGCAGTGGGGGG + Intergenic
1094218495 12:27970311-27970333 AACGCGCGCGGGGCGAGCGAGGG + Intronic
1094565030 12:31591172-31591194 TGGGAGCGCGGGGCGGGCGGGGG + Intergenic
1096155123 12:49337260-49337282 TGCGGGGGCGGGGCAGGCAGCGG + Intergenic
1096156613 12:49345000-49345022 CAGGCGGGCGGAGGGGGCGGGGG - Intergenic
1096435921 12:51591121-51591143 CGCGGGGGCGGGGCGGGCGGGGG + Intronic
1096435943 12:51591206-51591228 GACTCGGGCGGTGCGGGGGGCGG + Intronic
1096518944 12:52173445-52173467 CACAGGGACGGGGCGGGCGGGGG - Intronic
1096789046 12:54033948-54033970 GACTCGGGAGGGGCGGGAGGGGG + Intronic
1097267547 12:57755040-57755062 CGGGCGGGCGGGGCGGGCGCCGG - Intronic
1098161435 12:67649957-67649979 CCCGCGGGCGGCCCGGGCGGTGG + Intronic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100631988 12:96399441-96399463 TGCGCGGGTGGGGAGCGCGGAGG - Intronic
1100679850 12:96907332-96907354 TGCGCGGACGCGGCGGGCGGGGG - Intronic
1101605909 12:106247697-106247719 TGCGGGTGCGGCGCGGGCGGCGG + Exonic
1101963052 12:109264458-109264480 CTCGGGGGCGGGGAGGGCGGTGG + Intronic
1102973536 12:117190116-117190138 TCCGCGCGCGGGGCGGCCGCGGG + Intronic
1103348356 12:120265767-120265789 GCCGGGGGCGGGGCGCGCGGCGG - Exonic
1103363930 12:120369097-120369119 GCCGCGGGCGGCGCGGGCAGCGG + Exonic
1103962336 12:124617029-124617051 GAGGCGGGAGGGGAGGGCGGAGG - Intergenic
1104977756 12:132559927-132559949 AGCGCGGGCGGGGCGGGGGCGGG - Intronic
1106269484 13:28139096-28139118 TTTTCGGGCGGGGCGGGCCGCGG + Intronic
1107133529 13:36920367-36920389 TGCGCGGGCCCGGCGGGGGGCGG + Intronic
1107468143 13:40667087-40667109 GGCGCGGGGTGGGCGGGCGGAGG + Intergenic
1107605218 13:42049169-42049191 GGCGCGGGCGGGGCGGGGAGGGG + Intronic
1110318439 13:74135052-74135074 CGCGCCGGTGGGGCGGGCGGAGG + Intergenic
1110318614 13:74135594-74135616 CGGGCGGGCGGGGCGCGCGGCGG + Intergenic
1110436188 13:75481062-75481084 TTCGGGGGCTGGGCGAGCGGCGG - Intronic
1110705973 13:78602256-78602278 GGCGCGGGCGCGGCGGCCGGCGG - Exonic
1110712511 13:78665300-78665322 TGCGCGGGGGGTGGGGGCGGGGG - Intergenic
1112012119 13:95301316-95301338 TTGCCGGGCGGGGCGGGCGCGGG + Exonic
1112051126 13:95644461-95644483 GACGCGGGCCGGGCCCGCGGAGG + Intronic
1112507855 13:99985575-99985597 GGCGGCGGCGGGGCGGGCGGCGG + Exonic
1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG + Intronic
1113201183 13:107868210-107868232 GACGCGGACGGTGCGCGCGGAGG - Intergenic
1113552626 13:111204998-111205020 CACGGGGGCGGGGCGGGGTGGGG - Intronic
1113794773 13:113050718-113050740 GGCGGGGGCGGGGGGGGCGGGGG + Intronic
1113820532 13:113209502-113209524 CACGCGGGCGGGGCGGGGCGGGG + Intronic
1113907554 13:113826843-113826865 TGGGTGGGCGGGGTGGGCGGAGG - Intronic
1113948822 13:114059935-114059957 AACGCGGGCAAGGCTGGCGGGGG + Intronic
1114461161 14:22886968-22886990 GACGGGGGCGGGGCGGGGCGAGG - Exonic
1116945288 14:50830731-50830753 GGCGCGGGCTGCGCGGGCGGGGG - Intronic
1117315590 14:54567854-54567876 GGGGCGGGCGGGGCGGGCTGGGG + Exonic
1117547840 14:56808037-56808059 TGCGCGGGGGGCGCGGGCAGTGG - Intronic
1117587081 14:57220199-57220221 TGCGGGGGCAGGGGGGGCGGAGG - Intronic
1117988702 14:61413405-61413427 TACATGGGCGGGGCGGGGGGGGG - Intronic
1118220546 14:63851971-63851993 TAAGCGGGGGGGGGGGGGGGGGG + Intergenic
1119262542 14:73245998-73246020 GGCTCGGGCGGGGCGGGAGGTGG + Intronic
1119701980 14:76761797-76761819 GGCGCGGCCCGGGCGGGCGGAGG - Intergenic
1120345270 14:83280897-83280919 TGAACGGGCGGTGCGGGCGGTGG + Intergenic
1120904665 14:89609886-89609908 AACGAGGGCGGGGGCGGCGGCGG + Intronic
1121616994 14:95319930-95319952 GGCGCGGGCGGGGCGGGGCGGGG + Intergenic
1122162290 14:99793274-99793296 CTCGCGGGCGGAGCGGGCGCTGG + Intronic
1122206485 14:100150388-100150410 AATGGGGGCGGGGCGGGGGGGGG - Intronic
1122215482 14:100200875-100200897 TATGCTGGCTGGGCGCGCGGTGG - Intergenic
1122555170 14:102575046-102575068 CACGGGGGCGGGGCGGGGGGCGG - Intergenic
1122602953 14:102930329-102930351 TACGCGGGGCGGGGGCGCGGAGG + Intronic
1122666823 14:103335286-103335308 TATCCAGGCGGGGTGGGCGGCGG + Intronic
1122768209 14:104085644-104085666 TGGGAGGGCGGGGCCGGCGGGGG - Intergenic
1122904553 14:104795770-104795792 TCCGGGCGCGGGGCGGGCGCGGG - Intergenic
1122917331 14:104865200-104865222 GGCGGGGGCGGGGCGGGCGGGGG + Intergenic
1122978752 14:105181685-105181707 TCCGCGGGCGGGGCCGGGGGCGG + Intergenic
1123004452 14:105314678-105314700 GGCGCGCGCGGGGCGGCCGGGGG + Exonic
1123630740 15:22258196-22258218 GCCGCGGGCCGGGCGGGCGCCGG - Intergenic
1123739861 15:23226140-23226162 GACGGGGGCGGGGCGGGGCGGGG - Intergenic
1124427056 15:29570980-29571002 GGAGCGCGCGGGGCGGGCGGGGG - Intergenic
1125474725 15:40039260-40039282 TAGGCGGGCGGGGAGGGGGGAGG - Intergenic
1126786219 15:52179696-52179718 TTCCCGGGCGGGGACGGCGGGGG - Intronic
1128315060 15:66654971-66654993 GGCGCGGGAGGGGCGGGCCGCGG - Intronic
1128547745 15:68579216-68579238 GGCGCGGGCGCGGCGTGCGGGGG - Exonic
1129144245 15:73633091-73633113 GCCGGGGGCGGGCCGGGCGGGGG - Intronic
1129178898 15:73859279-73859301 GACGGGGGTGGGGGGGGCGGGGG - Intergenic
1129221674 15:74134994-74135016 TGGGCGGGCCGGACGGGCGGAGG - Exonic
1129387003 15:75201856-75201878 GTCCCGGGCGGGGCGGGCTGGGG - Intronic
1130041023 15:80405004-80405026 TTAGTGGGCGGGGCGGGCAGGGG - Intronic
1131055326 15:89371504-89371526 TATGAGGGCGGGGCGGGCGGCGG - Intergenic
1132499819 16:280365-280387 GGCACGGGCCGGGCGGGCGGCGG + Intronic
1132499897 16:280619-280641 GGCGGCGGCGGGGCGGGCGGCGG + Exonic
1132560088 16:589641-589663 GCCGGGGGCGGGGCGGCCGGCGG + Intronic
1132604586 16:788426-788448 TCCGCGGCGGGGGCGGGCCGGGG - Intergenic
1132623019 16:876716-876738 GAGGCGGGCTGGGCGGGCTGAGG + Intronic
1132683445 16:1153016-1153038 GCCGGGGGCGGGGCGGGCGGGGG - Intergenic
1132756012 16:1485858-1485880 TGTGCTGGCGGGGAGGGCGGTGG + Intergenic
1132757508 16:1493305-1493327 GACGCGGGAGCGGGGGGCGGTGG - Intergenic
1132841547 16:1980617-1980639 TACGGGAGCGGGGAAGGCGGTGG - Exonic
1132925966 16:2429304-2429326 GACATGGGCGGGGCCGGCGGCGG + Intergenic
1134143482 16:11742289-11742311 TCCGCGGGCGGGCCGGGGCGAGG + Intronic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134285013 16:12853819-12853841 TACCCGGGCGTGGTGGCCGGTGG - Intergenic
1135517610 16:23148924-23148946 GGCGCGGGAGAGGCGGGCGGCGG + Exonic
1136111022 16:28063622-28063644 CGGGCTGGCGGGGCGGGCGGCGG + Intergenic
1136365008 16:29805978-29806000 CGCGCGGGGAGGGCGGGCGGGGG - Intergenic
1136913047 16:34159740-34159762 CACTCGGGCGTGGCGGGCGCGGG - Intergenic
1136993329 16:35170395-35170417 CATGCGGGCGGGCCGCGCGGTGG - Intergenic
1137693121 16:50442842-50442864 TAAGCGGGGGGGGGGGGGGGGGG + Intergenic
1138242531 16:55439244-55439266 TACCTGGGCGGGGTGGGTGGGGG - Intronic
1138360798 16:56425576-56425598 GACGCTGGCGGGACGGGCGCAGG + Intergenic
1139364977 16:66427455-66427477 CGCGGGGGAGGGGCGGGCGGGGG + Intronic
1139528459 16:67530165-67530187 GAAGCGGGCGGGGAGGGCGCGGG + Intronic
1139534638 16:67563479-67563501 TACGCTGCCTGAGCGGGCGGGGG + Intronic
1139602292 16:67993935-67993957 TGTGCGGTCGGGGCGGGGGGCGG - Intronic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1140462221 16:75148838-75148860 TGCGGGGGCGGGGACGGCGGAGG + Intronic
1141662320 16:85448107-85448129 GATGCGGGCAGGGCAGGCGGAGG - Intergenic
1141972305 16:87492377-87492399 GCCGCGGGCCGGGCGGGCGCCGG + Intergenic
1142156474 16:88534740-88534762 GACGGGGGCGGGCCGGGCGGCGG - Exonic
1142178292 16:88655174-88655196 GACGCGGGCCGGGAGGGCAGAGG - Intronic
1142184205 16:88686615-88686637 TGCGCGGGCGGGACGGGGCGGGG + Intergenic
1142379041 16:89721486-89721508 GAGGCGGGCGGGGCGGGCCAGGG - Intronic
1142560216 17:805182-805204 CACGCGGCAGGGGCGGGTGGAGG - Exonic
1142711508 17:1726232-1726254 GTAGCAGGCGGGGCGGGCGGCGG + Exonic
1142785919 17:2222541-2222563 TGCGGGGGCGGGGGGGGGGGGGG + Intronic
1142859029 17:2749729-2749751 GCCGTGGGCGGGGCGGGGGGAGG + Intergenic
1142950125 17:3471782-3471804 TTCGCGGGCGGGAAGGGCGGCGG - Exonic
1143483101 17:7238427-7238449 TACGGGGGCGGAGGGGGGGGCGG - Intronic
1143492894 17:7294364-7294386 AAAGGCGGCGGGGCGGGCGGCGG - Exonic
1143661477 17:8327098-8327120 CCCGCGGGAGGGGCGGGCGCGGG - Intergenic
1144473376 17:15563599-15563621 TCCAGGGGCGGGGCGAGCGGGGG + Exonic
1144473384 17:15563614-15563636 AGCGGGGGCGGGGCGAGCGGGGG + Exonic
1144473391 17:15563629-15563651 AGCGGGGGCGGGGCGAGCGGGGG + Exonic
1144473398 17:15563644-15563666 AGCGGGGGCGGGGCGAGCGGGGG + Intergenic
1144473405 17:15563659-15563681 AGCGGGGGCGGGGCGAGCGGGGG + Intergenic
1144473412 17:15563674-15563696 AGCGGGGGCGGGGCGAGCGGGGG + Intergenic
1144473419 17:15563689-15563711 AGCGGGGGCGGGGCGAGCGGGGG + Intergenic
1144923105 17:18781121-18781143 TCCAGGGGCGGGGCGAGCGGGGG - Exonic
1145950515 17:28813018-28813040 TAAGCGGGGGGGGGGGGGGGGGG + Intronic
1147909571 17:43847376-43847398 TAGGGGAGCGGGGCGGGCTGGGG + Intronic
1147987587 17:44315344-44315366 GGGGCGGGCGGGCCGGGCGGGGG + Intronic
1148071162 17:44909618-44909640 CTCTCGGGCGGGGCGGGGGGAGG - Intronic
1148090264 17:45019101-45019123 GGCGCGGGCGGCCCGGGCGGGGG + Intergenic
1148139191 17:45316629-45316651 CAGGCGGGCGGGCCTGGCGGCGG + Intronic
1148736610 17:49868691-49868713 CAGGCAGGCAGGGCGGGCGGCGG - Intergenic
1148786829 17:50149723-50149745 TCCCCCGACGGGGCGGGCGGCGG + Exonic
1148786958 17:50150284-50150306 CCCTCGGGCGAGGCGGGCGGCGG - Exonic
1148830175 17:50426115-50426137 TCCGCCGGCGGGGCGGGGCGGGG - Intergenic
1148880152 17:50719487-50719509 TCCGGGGGCGGGGCCCGCGGAGG - Intergenic
1148945866 17:51260958-51260980 CACTCGGGCGGGGCGCGCGGTGG + Intronic
1150904910 17:69327027-69327049 GAGGCGGGCGTCGCGGGCGGCGG - Intronic
1151570440 17:74923081-74923103 GAAGTGGACGGGGCGGGCGGGGG + Exonic
1151755860 17:76074914-76074936 AACGCGAGCCAGGCGGGCGGCGG + Exonic
1152069793 17:78128790-78128812 CACGTGGGCGGGGGGGGGGGGGG + Intronic
1152107998 17:78341975-78341997 TCCGCGGGCGGGGTGGGGGCGGG + Intergenic
1152321652 17:79611334-79611356 CGCGCGGCCGGGGAGGGCGGCGG + Intergenic
1152544065 17:80992025-80992047 GACGGGGCCGGGGCGGGCGGCGG + Intronic
1152628687 17:81399923-81399945 TGCTCGGCCGGGGCGGGCGCGGG + Intronic
1153006274 18:500804-500826 GCCGAGGGCGGGGCGGGCGCGGG - Intergenic
1153051987 18:908416-908438 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1153285387 18:3450972-3450994 TAGGGGGGCGGCGGGGGCGGGGG - Intronic
1153480690 18:5543661-5543683 GCGGCGGGCGGAGCGGGCGGGGG + Intronic
1153565676 18:6414962-6414984 CATGCGCGCGGGGCGGGCAGGGG - Intronic
1153900636 18:9614561-9614583 GACGCGCGCGGGAGGGGCGGCGG + Intronic
1153900656 18:9614611-9614633 CGCGCGCGCGGGGCGGGCCGAGG + Intronic
1154241474 18:12657623-12657645 CACGGTGGCGGGGCTGGCGGCGG + Exonic
1154345805 18:13542655-13542677 TAAGGAGGCGGGGCGGGCGGAGG + Intronic
1155229173 18:23756950-23756972 TACTGGGGCGGGGCGGGGCGGGG - Intronic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1158954805 18:62527010-62527032 TTCGGGGGGGGGGGGGGCGGGGG - Intronic
1160163269 18:76491403-76491425 GGGGCGGGCGGGGCGGGCGGGGG - Intronic
1160613949 18:80109698-80109720 GCGGCGGGCGGGGCGGGCCGCGG - Intronic
1160738708 19:676330-676352 GCCGCGGGCGGGGCGGGGCGCGG - Intergenic
1160822426 19:1064769-1064791 TACGCGGGCGGGGGGTGGCGGGG + Intronic
1160859009 19:1229834-1229856 GGCGCGGGCGGGGAGGGCGGCGG + Exonic
1160861891 19:1240759-1240781 AACCCGGGCGGGGGGGGGGGGGG - Intergenic
1160864103 19:1249598-1249620 GGCGCGGGCGGGGCGGGGGCGGG + Intronic
1160937820 19:1605485-1605507 CACGCGCGCGGGGAGGGCGGGGG + Exonic
1160947954 19:1652218-1652240 AGCGCGCGCGGGGCGGGCCGGGG + Intronic
1160967714 19:1753870-1753892 GGCGCGGGCAGCGCGGGCGGCGG + Exonic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1161038201 19:2096818-2096840 TGCGCTGGTGGGGCGGGCGGGGG + Intronic
1161150108 19:2702875-2702897 GGCGCGGGCGGGGCCGGGGGCGG + Intergenic
1161505058 19:4639433-4639455 CGCGCGGGCGGGGCGAGTGGAGG + Intergenic
1161925239 19:7294494-7294516 GAGGCGGGCGGGGCGGGGCGGGG - Intergenic
1162118234 19:8445153-8445175 TCCGCGGCCGACGCGGGCGGCGG + Intronic
1162363149 19:10231363-10231385 GAGGAGGGCGGGGCGAGCGGGGG - Intergenic
1162798498 19:13098673-13098695 GACGGGGGCGGGGCGGGGCGGGG - Intronic
1162809121 19:13153763-13153785 CACGCGGGCGGCGCCGTCGGAGG - Exonic
1162935328 19:13978988-13979010 CACGCGGGCGGCCGGGGCGGCGG + Intronic
1163089716 19:15011232-15011254 CGCGCGGCCGAGGCGGGCGGCGG - Exonic
1163138605 19:15331833-15331855 TACCCGGGCCGGGCGCGCCGCGG + Intronic
1163282317 19:16325336-16325358 AACGCAGGCGGCGGGGGCGGCGG - Exonic
1163427158 19:17245936-17245958 TTCGCGGGGCGGGCGGGGGGCGG + Exonic
1163607137 19:18281566-18281588 GCCGCGGCCGGGGCGGGCGCAGG - Exonic
1163845753 19:19637398-19637420 AAGGCGGGCGGCGGGGGCGGCGG + Exonic
1164388258 19:27794843-27794865 TCCGCGGGCAGGCCAGGCGGCGG - Intergenic
1164594773 19:29525875-29525897 GGCGGGGGCGGGGCGGGCTGTGG + Intergenic
1165058551 19:33194222-33194244 GGCGCTGGCTGGGCGGGCGGAGG - Intronic
1165461099 19:35944912-35944934 GGGGCGGGCGGGGCGGGCGTGGG - Exonic
1165468229 19:35987490-35987512 TAGGCGGGGGGGGGGGGGGGTGG + Intergenic
1165832277 19:38735864-38735886 TCTGCGGGCGGGGCGGGGCGGGG + Intronic
1166042900 19:40214005-40214027 GGCGCGGGCGGGGAGGGTGGTGG - Exonic
1166094192 19:40529453-40529475 GAGAGGGGCGGGGCGGGCGGTGG + Intronic
1166799984 19:45450894-45450916 TGCGCGGGCGTGGGGGGGGGGGG - Intronic
1166882923 19:45940164-45940186 GCCGCGGCCGGGGCGGCCGGGGG - Exonic
1166882948 19:45940224-45940246 CTCGGGGCCGGGGCGGGCGGCGG - Exonic
1166882993 19:45940332-45940354 TACGCGGGCGAGGCCGGGGCCGG - Exonic
1167248912 19:48390709-48390731 TGCTCAGGCGGGGCGGGCTGGGG - Intronic
1167377291 19:49119024-49119046 CACGAGGGCTGGGCGGGCAGCGG - Exonic
926685432 2:15694378-15694400 TGCGCGTGCTGGGCGGCCGGCGG - Intronic
927619215 2:24634709-24634731 TCCGGGGGCGGGGGGGGGGGGGG - Intronic
929665636 2:43831897-43831919 TAAGCCCCCGGGGCGGGCGGGGG + Intronic
930124348 2:47783890-47783912 TTGGTGGGCGGGGCGGGGGGCGG + Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933206437 2:79512974-79512996 GACGCGGGGCGGGCGGGGGGAGG + Intronic
934079023 2:88452180-88452202 GAGGCGGGCGCGGCGGGCGCGGG + Exonic
934955225 2:98611963-98611985 TGGGGGGGCGGGGGGGGCGGAGG - Intronic
935592545 2:104855583-104855605 GACGCGGCAGGGGCTGGCGGCGG + Exonic
935595196 2:104872643-104872665 CACGCGGGCCGGCGGGGCGGAGG - Intergenic
935731019 2:106065280-106065302 GGCGCGGCTGGGGCGGGCGGAGG + Intronic
936104497 2:109613667-109613689 TGGGCGGGCGGGGCCGGAGGGGG + Intronic
936507087 2:113116483-113116505 CACCCAGGCGGGGCGGGGGGTGG + Intronic
937119458 2:119431779-119431801 GAGGCGGGCGGGGCGGGAGGGGG - Intronic
937283399 2:120735737-120735759 AACGCCGCCGGGGCGGGGGGAGG - Intronic
938034705 2:128027105-128027127 GAAGCGGGCGGTGCGGGCGGCGG - Exonic
938406246 2:131034881-131034903 TGTGCGGGCGGGGGCGGCGGCGG - Intronic
939613036 2:144332597-144332619 TGCGCGGGCGGGCCGAGGGGCGG - Intergenic
940918921 2:159286656-159286678 GAGGCTGGCGGGGCGGGCGCCGG + Intronic
942448390 2:176093043-176093065 GACGCATTCGGGGCGGGCGGCGG + Exonic
942453585 2:176123144-176123166 TTCCCGGGCGGTGCGGGCGGTGG + Exonic
942678190 2:178450742-178450764 GCGGCGCGCGGGGCGGGCGGAGG - Intronic
944060137 2:195563275-195563297 TGCGGGGGCGGGGGGGGCGGAGG - Intergenic
944114289 2:196171099-196171121 TCCGCGCGGGGGGCGGCCGGCGG - Intronic
945225916 2:207530588-207530610 GCCGGGGGCGAGGCGGGCGGCGG - Intronic
945251678 2:207769901-207769923 GACCCGGGCGGGGCGGGAGAGGG - Intergenic
946242985 2:218368011-218368033 GACGCGGGCGGGACGCGCCGGGG + Exonic
947741754 2:232487907-232487929 GGGGCGCGCGGGGCGGGCGGAGG - Intergenic
948598730 2:239096481-239096503 CATGGGGGCGGGGCGGGGGGCGG - Intronic
948805926 2:240453438-240453460 TGCGGGAGCGGGGCGGGCGGAGG - Intronic
948824210 2:240566556-240566578 TCCTCGGGCGGGGCGGGGCGGGG + Intronic
948991761 2:241559161-241559183 TGCGTGGGCGGCGGGGGCGGAGG - Intronic
949000478 2:241610265-241610287 TTCCGGGGCGGGGCCGGCGGAGG - Intronic
1168878314 20:1185698-1185720 CGCAGGGGCGGGGCGGGCGGGGG + Intronic
1170756981 20:19213091-19213113 TAAGCGGGCTGGGTTGGCGGGGG + Intronic
1171849814 20:30300408-30300430 GACCCGGGCGGGGCGGGCGGCGG - Intergenic
1171986002 20:31661748-31661770 AAAGCGGGCGGGGCGGGGCGGGG + Intergenic
1172284622 20:33732097-33732119 TGCGAGGGCGCGGCGGGAGGGGG - Intronic
1172474446 20:35226640-35226662 CACCGGGGCGGGGCGCGCGGAGG + Exonic
1172654390 20:36528160-36528182 TAGGAGTGCGGGGCGGGGGGAGG - Exonic
1172688341 20:36773884-36773906 TACGCATGCGCGTCGGGCGGCGG - Intergenic
1172793579 20:37522564-37522586 TGGGCGGGCGGGGCAGGGGGTGG + Intronic
1173279730 20:41617971-41617993 GCCGCGGGCCTGGCGGGCGGGGG - Intronic
1173548127 20:43914737-43914759 CGCGCGGGCGGGGCGGGGGCGGG + Intergenic
1173649103 20:44651741-44651763 GCGGCGGGCGGGGCGGGAGGCGG - Exonic
1173852720 20:46228888-46228910 GAGGCGGGAGAGGCGGGCGGCGG - Intronic
1173880290 20:46406607-46406629 CAAGAAGGCGGGGCGGGCGGAGG - Exonic
1174586794 20:51615088-51615110 TGGGGGGGCGGGGCGGGGGGTGG + Intronic
1175349569 20:58309043-58309065 TCCCTGGGCGGGGCGGGCTGAGG - Intergenic
1175429512 20:58891644-58891666 CACGCGGGCCGGGAGGGCCGGGG - Intronic
1175714650 20:61247332-61247354 GAGGCGGGCGGGGTGGGGGGGGG + Intergenic
1175994118 20:62804784-62804806 GAAGCGCGGGGGGCGGGCGGGGG - Intergenic
1175997147 20:62816999-62817021 CGGGCGGGCGGGGCGGGAGGTGG - Intronic
1176005854 20:62861902-62861924 GGCGGGGGCGGGGCCGGCGGCGG - Intergenic
1176080861 20:63272524-63272546 AACGGGGGCGGGGCGGGTGGGGG - Intronic
1176125275 20:63472270-63472292 CGCGCGGGCGGCGCGGGCGCCGG - Exonic
1176156927 20:63626760-63626782 CAGGCGGGCGGCGCGGGCGGTGG - Intronic
1176234614 20:64048605-64048627 TCCTCGGGCGCCGCGGGCGGTGG + Exonic
1176549303 21:8214501-8214523 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176557196 21:8258724-8258746 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176568235 21:8397539-8397561 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176576138 21:8441759-8441781 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1177431702 21:20998291-20998313 GAGCCGGGCGGGGAGGGCGGCGG - Intergenic
1178488463 21:33033241-33033263 TGGGCGCGCGGCGCGGGCGGAGG + Intergenic
1179209345 21:39312940-39312962 GGCGCGGGGGGGGCGGGGGGCGG + Intronic
1179529542 21:42009633-42009655 TCCGCGGGAGGGGCCGGGGGCGG + Intronic
1179786466 21:43733260-43733282 TTCCAGGGCGGGGGGGGCGGGGG - Intronic
1179801966 21:43815335-43815357 TGGGTGGGCGGGGCGGGAGGCGG + Intergenic
1180074741 21:45456731-45456753 CAGGGTGGCGGGGCGGGCGGCGG - Intronic
1180110134 21:45643613-45643635 GGCGGGGGCGGGGCCGGCGGCGG + Intergenic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1180908368 22:19431583-19431605 TGAGGGCGCGGGGCGGGCGGCGG - Exonic
1180949410 22:19714455-19714477 CGCGCGGGCGGAGCGGGCGGCGG + Exonic
1180959239 22:19755249-19755271 ACCGCGGGCGGGGGTGGCGGGGG - Intergenic
1181068749 22:20319855-20319877 TACGCAGGCGGGGCGGGCGGAGG - Intronic
1181283532 22:21736166-21736188 TCGGCCGGCGGGGCTGGCGGTGG + Intergenic
1181787643 22:25238400-25238422 GGCGGGGGCGGGGCGGGGGGTGG + Intergenic
1182149513 22:28018298-28018320 TGCGCGCGCGGGGGGGGGGGCGG + Intronic
1182779258 22:32854701-32854723 TACGCGGTGGGGGCGCGGGGTGG - Intronic
1183461277 22:37952535-37952557 TTCGGGGGCGGGGCGGGGCGGGG - Intronic
1184043438 22:41957936-41957958 TGGGCGGGCGGGGCGGGCTGGGG - Intergenic
1184073433 22:42161255-42161277 CACGCGGGCGGGGCGGGGCGGGG + Exonic
1184101390 22:42343446-42343468 AGCGCGGGCGCGGCGGGGGGCGG - Intronic
1184236772 22:43187183-43187205 GAGGAGGGCGGGGCGGGGGGGGG - Intergenic
1184236788 22:43187210-43187232 GAGGAGGGCGGGGCGGGGGGGGG - Intergenic
1184236804 22:43187237-43187259 GAGGAGGGCGGGGCGGGGGGGGG - Intergenic
1184236828 22:43187276-43187298 GAGGCGGGCGGGGCGGGGGGCGG - Intergenic
1184445304 22:44543758-44543780 TGCTCGGCGGGGGCGGGCGGGGG + Intergenic
1184523860 22:45010066-45010088 GGCGCGGGCGGGGCGGGGGCGGG - Intergenic
1184525805 22:45021659-45021681 GTCGGGGGCGGGGCGGGGGGAGG - Intergenic
1184796966 22:46738277-46738299 TACGCGGGCGGCGGGGACCGCGG + Intergenic
1185055396 22:48576244-48576266 GCCGCGGAGGGGGCGGGCGGGGG - Intronic
1185156416 22:49195925-49195947 CACGCTGGCAGGGCGGTCGGAGG - Intergenic
1203254188 22_KI270733v1_random:130817-130839 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203262244 22_KI270733v1_random:175896-175918 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
950004483 3:9682939-9682961 TACTCGGGGGGCGGGGGCGGGGG - Intronic
950153736 3:10707683-10707705 GCGGCGGGCGGGGCGGGCCGGGG - Intronic
951139803 3:19147231-19147253 AACTCGGGCGTGGCGGGAGGAGG - Intergenic
952451789 3:33440149-33440171 GCCCCGGGCGGGGCGGTCGGCGG - Exonic
953404656 3:42654471-42654493 GCCTCGGGCGCGGCGGGCGGGGG - Intronic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
954004382 3:47579387-47579409 CACGAGGGAGGGGCGGGCGTTGG + Exonic
954110220 3:48429393-48429415 CGCGCGGGAGGGGCGGGCAGCGG - Exonic
954313219 3:49786297-49786319 GACGCCCGCGGGGAGGGCGGTGG - Intronic
955188014 3:56733318-56733340 GAGGTGGGCGGGGCGGGGGGGGG + Intronic
958936394 3:100260744-100260766 GCCGCGGGCGGGGCGGGGCGCGG - Intergenic
960223767 3:115146985-115147007 GGCGCGGGCGGGGCGGGGCGGGG + Intronic
961446214 3:126982996-126983018 GGCGGGGGCGGGGCCGGCGGCGG - Intergenic
961735711 3:129001239-129001261 CAGGCGGGCGGGGCGGAGGGAGG + Intronic
961735935 3:129002174-129002196 CAGGCGCGCAGGGCGGGCGGCGG - Exonic
961827241 3:129605585-129605607 TGCGCGGGCGGCGCGGGCCGCGG - Exonic
962134778 3:132722282-132722304 GACACGTACGGGGCGGGCGGCGG - Exonic
962222348 3:133574174-133574196 GCCGCGGGTGCGGCGGGCGGCGG + Exonic
963733271 3:148992115-148992137 GCCGGGGCCGGGGCGGGCGGCGG - Intronic
966350139 3:179024838-179024860 CCCGGGGGCGGGGCGGGGGGAGG - Exonic
966854720 3:184186134-184186156 TTCGGGGGCAGGGCGGGGGGCGG + Exonic
966868554 3:184275997-184276019 GACTCGGGCGGGGGGGGGGGCGG + Intronic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
967859676 3:194141527-194141549 GCCGCGGGGGGAGCGGGCGGCGG + Intergenic
968043841 3:195612435-195612457 TGCGGGGGCGGGGCTGGAGGAGG + Intergenic
968084513 3:195868349-195868371 TAGGCGGGCGGGGGGGGCAGCGG + Exonic
968136653 3:196224684-196224706 GAAGGGGGCGGGGCGGGGGGGGG + Intronic
968483948 4:849836-849858 TTCAGGGGCGGGGCGGGGGGGGG - Intronic
968556544 4:1248835-1248857 CGCGCGGGCGGGGGGCGCGGGGG - Intronic
968606129 4:1536522-1536544 GCAGCGGGCGGGGGGGGCGGTGG + Intergenic
968653076 4:1767567-1767589 GTCGGGGGCGGGGCCGGCGGGGG + Intergenic
968660022 4:1794998-1795020 ACCGCGGGCGCGGCGGGCCGGGG + Intronic
968701057 4:2058648-2058670 TGCGCGGCCGCGGGGGGCGGGGG + Intergenic
968908047 4:3463549-3463571 CAGGTGAGCGGGGCGGGCGGGGG + Exonic
969285292 4:6199173-6199195 TGCGCAGATGGGGCGGGCGGCGG + Intronic
969295655 4:6269582-6269604 TCCGCGGGCGGGGCGGGGGCGGG + Intergenic
969821351 4:9722816-9722838 TAAGCGGGCGGGGTGGAAGGCGG + Intergenic
975118442 4:70704749-70704771 GACCCTGGCGGGGCGGGCTGTGG + Intronic
975541076 4:75512900-75512922 TAAGGGGGGGGGGGGGGCGGGGG + Intronic
975986180 4:80202906-80202928 GCCGCAGGCGGCGCGGGCGGGGG + Exonic
976297307 4:83485101-83485123 GACGAGGGCGGGGCGCGCGGAGG + Exonic
977574070 4:98658689-98658711 GCTGCGGGCGGCGCGGGCGGAGG - Intergenic
977607221 4:98995548-98995570 TGCGCGCGCGGGGCGGGGGCGGG + Intergenic
980053795 4:128061534-128061556 TGCGCGGCCTCGGCGGGCGGCGG + Intronic
981070002 4:140524424-140524446 TTCGCGGGCGGCGCGCGAGGGGG + Intronic
981128616 4:141133390-141133412 GCCGCGGGCGGGGCGGGCTTGGG + Intronic
981528670 4:145732644-145732666 TTCCTGGGCGGGGCGGGTGGGGG - Exonic
981761891 4:148203650-148203672 AACGGGGGCGGGGCGGGGGGAGG - Intronic
982766555 4:159355879-159355901 TAGCCGGGAGGGGTGGGCGGGGG - Exonic
984928256 4:184825651-184825673 GTCGCGGGCGGCGCGGGCGCGGG - Intronic
985497604 5:218435-218457 GACCGGGGCGGGGCAGGCGGGGG + Intronic
985737718 5:1594356-1594378 GACCGGGGCGGGGCAGGCGGGGG - Intergenic
987415390 5:17656239-17656261 TCCGGGAGCGGGGTGGGCGGGGG + Intergenic
989379398 5:40798339-40798361 CCCCCTGGCGGGGCGGGCGGGGG + Exonic
990753117 5:59039431-59039453 TCGGCAGGCGGGGCGGGCGTGGG - Intronic
992067402 5:73120507-73120529 TGCGCGGGCGCGGCGGCCCGGGG - Exonic
992088620 5:73299151-73299173 AGCGCCGGCGGGCCGGGCGGGGG - Intergenic
992365440 5:76084678-76084700 GACCCGCGAGGGGCGGGCGGGGG + Intronic
992474267 5:77087125-77087147 AACGCGGCCGGAGCCGGCGGCGG + Exonic
992663608 5:78984901-78984923 GGCGGGGGCGGCGCGGGCGGCGG + Intronic
992939921 5:81751437-81751459 AGCGCGGGCGGCGCGGGGGGAGG - Intronic
996404175 5:123090171-123090193 TCCGGGGGCGGGGGCGGCGGCGG - Exonic
997470582 5:134114925-134114947 GGCGGGGGCGGCGCGGGCGGCGG + Exonic
998374479 5:141681952-141681974 GGCGGGGGCGGGGCGGGCAGTGG + Intronic
999399363 5:151252834-151252856 TGCGCGCGCGGGAGGGGCGGGGG - Intronic
1000071479 5:157744204-157744226 TCCGCGGGCCGGGCGGGAAGCGG + Intronic
1000486304 5:161848501-161848523 TAGTCGGGGGGGGGGGGCGGGGG + Intronic
1001586005 5:172834311-172834333 GGCGGGGGCGGGGCGGCCGGAGG + Exonic
1001653260 5:173329786-173329808 GGCGCGGGCGGGGCGCGGGGCGG - Intergenic
1001902618 5:175444309-175444331 TCTGCGGGCGAGGTGGGCGGAGG + Intergenic
1002091857 5:176810715-176810737 CAGGCGGGCGGGCCGGGCGCGGG - Exonic
1002441273 5:179265693-179265715 CACGCGGAAGGGGTGGGCGGGGG - Intronic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002927104 6:1611046-1611068 TGCTCCGGCGGCGCGGGCGGGGG - Exonic
1002927270 6:1611652-1611674 TACGCGGCCGGCGAGCGCGGGGG + Exonic
1003552192 6:7109016-7109038 CTCGCGGGCGGGGGGGGTGGGGG + Intronic
1004529359 6:16439334-16439356 TTCGCGGGGGGGGGGGGGGGGGG + Intronic
1004561804 6:16759968-16759990 TGCGCGCGCGCGCCGGGCGGGGG - Intronic
1004562088 6:16760907-16760929 GGCGCGGGCGGGGAGAGCGGCGG - Intronic
1004614963 6:17281090-17281112 GAAGCGGGCGGGGGGCGCGGCGG - Intergenic
1005040334 6:21595141-21595163 GTGGCGGGCGGCGCGGGCGGTGG + Exonic
1005825279 6:29628294-29628316 CAGGAGGGCGGGGTGGGCGGAGG + Intronic
1006180723 6:32151960-32151982 GGGGCGGGGGGGGCGGGCGGAGG + Intronic
1006396229 6:33789131-33789153 TGCGCGCCAGGGGCGGGCGGGGG - Exonic
1007390181 6:41546342-41546364 CGCGCGGGCGGGGCGGGAGGGGG - Intergenic
1007479828 6:42142556-42142578 TGCGCGGGCGGGGAGGACGGCGG - Intronic
1007673477 6:43575951-43575973 TACCGGGCCGCGGCGGGCGGCGG + Exonic
1007673516 6:43576102-43576124 TAGGTGGGCGGGGCGGGAGGCGG + Intergenic
1008625205 6:53308878-53308900 TGCGCAGGTGGGGCGGGGGGCGG + Intronic
1011042516 6:83046668-83046690 TTGGCGGGGGGGGTGGGCGGTGG + Intronic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1011640442 6:89412197-89412219 TCCGCCGGCGGGCGGGGCGGGGG - Exonic
1012400118 6:98835588-98835610 TGCGGGGGCGGCGGGGGCGGCGG - Exonic
1012450549 6:99349469-99349491 GGCGCGGGCGGCGCGGGCGGCGG + Exonic
1013117560 6:107114723-107114745 GGCGCGAGTGGGGCGGGCGGCGG + Intronic
1013538995 6:111088540-111088562 TATGTTGGCGGGGCGGGGGGTGG + Intronic
1014272643 6:119350165-119350187 GACCCGTGCGGGGCGGTCGGGGG + Intergenic
1015120469 6:129695858-129695880 TAGGTGGGTGGGGCGGGTGGTGG - Intronic
1015935710 6:138404423-138404445 CACGCAGGCGGGGCGGCCCGGGG + Exonic
1016034463 6:139372504-139372526 TATGGGGGTGGGGGGGGCGGCGG + Exonic
1017842425 6:158232431-158232453 TTGGTGGGCGCGGCGGGCGGGGG + Intronic
1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG + Intronic
1018046413 6:159969578-159969600 TGCGCAGGCGGGGGGCGCGGGGG + Intronic
1018613399 6:165663276-165663298 TACGTGGGCGCGGAAGGCGGCGG - Intronic
1018956366 6:168413049-168413071 TACGCGGGCGTGGCGGGCTCTGG + Intergenic
1019343004 7:517352-517374 TCCGCGCGCGGGGAGGGCGCGGG - Intronic
1019343711 7:519909-519931 GAGGCGGGGGGGGGGGGCGGGGG - Intronic
1019509994 7:1412997-1413019 GACGCGGGCGGGGAGGGCGCCGG + Intergenic
1019563268 7:1668097-1668119 TACGCGCGCGGGGCCGTGGGAGG - Intergenic
1019601251 7:1884840-1884862 GACGCAGGCGGGGCAGGCCGTGG + Intronic
1019739636 7:2666173-2666195 TATGTGGGCGGGGGGGGGGGGGG + Intergenic
1020034988 7:4959221-4959243 GGCGGGGGCGGGGCGGGCGGGGG + Intergenic
1021313260 7:19117468-19117490 TCCGCGGGGAGGGCGCGCGGGGG + Exonic
1021450273 7:20778040-20778062 CAGGCGAGCGGGGCGGGGGGAGG + Intergenic
1021653601 7:22854150-22854172 CCCGCGGGCGGGGCGGGTGCTGG + Intergenic
1021969364 7:25951382-25951404 GGCGGGGGCGGGGTGGGCGGTGG + Intergenic
1022340979 7:29468142-29468164 TAGTCGGGCGGGGGGGGGGGGGG - Intronic
1023029987 7:36083083-36083105 TACTCTGGCGGGGCGGGAGAGGG - Intronic
1023427911 7:40058562-40058584 AAAACGGGCAGGGCGGGCGGGGG + Intronic
1023792480 7:43764160-43764182 TGCGGGGGCGGGGCGGGCAGGGG - Intronic
1023810493 7:43907462-43907484 GAAACGGGCGGGGCGGGCAGGGG - Intronic
1023937110 7:44748370-44748392 GGCGCGGGCGGGGCGGGTGGGGG + Intergenic
1023955725 7:44885371-44885393 GGCGCGAGCGCGGCGGGCGGTGG - Intergenic
1024707189 7:51973180-51973202 GTGGCGGGCGGGGCGGGTGGGGG - Intergenic
1025259122 7:57405308-57405330 TGCACTGGCGGGCCGGGCGGCGG - Intergenic
1026523132 7:71133072-71133094 GACGCGGGCGGGCCGGGCACAGG + Intronic
1029139716 7:98401120-98401142 GAGGCGGGCGGGGCAGACGGGGG + Intergenic
1029456820 7:100675870-100675892 AACTGGGGCGGGGGGGGCGGGGG - Intronic
1029535268 7:101154321-101154343 AGCGCGGGCGGGGCTGGAGGCGG - Intergenic
1032020710 7:128405971-128405993 GCCGCGGGCCGGGCGGGCCGGGG + Intronic
1032174555 7:129612293-129612315 TACGCGGGCGGGCGGGCGGGCGG + Intronic
1032438687 7:131924153-131924175 TACTCGGGGGAGGGGGGCGGGGG - Intergenic
1033299972 7:140176822-140176844 TACACGGGCGGGGGCGGCGGAGG + Exonic
1033662050 7:143408869-143408891 GAGCCGGGCGGGCCGGGCGGGGG + Exonic
1034552580 7:151830774-151830796 GATGGGGGCGGGGCGGGGGGGGG + Intronic
1035187582 7:157138682-157138704 GACGCGGGCTGGGCACGCGGCGG - Intergenic
1035720938 8:1791405-1791427 GACTGGGGCGGGGCGGGGGGAGG - Intergenic
1038540493 8:28386320-28386342 GAGGCGCGGGGGGCGGGCGGGGG - Intronic
1039453914 8:37695938-37695960 TGGGGGGGCGGGGAGGGCGGGGG - Exonic
1039493586 8:37965330-37965352 GAAGAGGGCCGGGCGGGCGGCGG + Exonic
1039514504 8:38120619-38120641 TATGCGGGGGGGGGGGGGGGGGG - Intronic
1041690391 8:60680394-60680416 GTCGCGGGGGGGGGGGGCGGGGG + Intronic
1042271505 8:66961352-66961374 TAAGCGGGCGGGGCGCACCGCGG - Intronic
1043463954 8:80486952-80486974 AGCGCGGGCGGCGCTGGCGGCGG - Exonic
1044734801 8:95268747-95268769 TCTGCGGGCGGGGCGGGGCGGGG + Intronic
1047393664 8:124474812-124474834 TCCGCGGGCGGGGGAGGCAGTGG + Exonic
1047961753 8:130016323-130016345 CGCGCGGGCCGGCCGGGCGGCGG + Intronic
1049109794 8:140635642-140635664 GACGCGGCCGGGGCGGCGGGCGG + Intergenic
1049693683 8:143973572-143973594 TGCGGGGGCGGGGCGGGGGCGGG - Intronic
1049756676 8:144313917-144313939 TAGGCGGGCGGGGGGTGAGGGGG + Intronic
1049761522 8:144333954-144333976 TCCGGGCGCGGGGTGGGCGGCGG + Exonic
1049879445 8:145052251-145052273 GGCGCGGGCGGGGCGGGGAGCGG - Intergenic
1049879458 8:145052278-145052300 GGCGCGGGCGGGGCGGGGCGCGG - Intergenic
1050231107 9:3526438-3526460 TTCCGGGGCGGGGCGGGCAGAGG + Intergenic
1050500525 9:6293535-6293557 TATGGGGGCGGGGGGGGTGGTGG + Intergenic
1054175862 9:61875038-61875060 GACCCGGTCGGTGCGGGCGGCGG - Intergenic
1054661677 9:67705770-67705792 GACCCGGTCGGTGCGGGCGGCGG + Intergenic
1055900011 9:81223372-81223394 AACCCGGGGGGGGCGGGAGGTGG + Intergenic
1056643414 9:88388998-88389020 GACGGGGGCGGGGCGGGGGGAGG + Intronic
1057596446 9:96418871-96418893 ACCGAGGGCGGGGCGGGCGGCGG - Intergenic
1057596549 9:96419271-96419293 GACGCGGCCGGGGCAGGTGGGGG - Intergenic
1058023714 9:100117604-100117626 GAGGTGGGCGGGGGGGGCGGGGG - Intronic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1059470938 9:114504722-114504744 TCGGCGGCCGGGGCGGGCGGCGG - Exonic
1060106783 9:120877442-120877464 CGCGCCCGCGGGGCGGGCGGGGG - Intronic
1060468731 9:123930158-123930180 AGCGCGGGCGGGAGGGGCGGTGG - Intergenic
1060514827 9:124258840-124258862 TACACAGGCTGGGCGAGCGGAGG + Intronic
1060825110 9:126683297-126683319 GCCGCGGGCCGGGCGGGCGGCGG - Intronic
1061050393 9:128191578-128191600 AATGCGGGCGGGGCCGGCCGGGG + Exonic
1061050691 9:128192935-128192957 TGGGCGGGCAGGGCGCGCGGGGG + Intronic
1061075733 9:128340492-128340514 TGCGCGAGCAGGGCGGGCTGGGG + Intergenic
1061212674 9:129202922-129202944 GGCCCGGGCGGGGCGGGCGCTGG - Intergenic
1061975883 9:134067888-134067910 GCGGCGGGCGGCGCGGGCGGCGG - Intronic
1061975887 9:134067900-134067922 TGCGCGCGCGGGGCGGCGGGCGG - Intronic
1061976104 9:134068542-134068564 CGCGCGCGCGGGGCGGGGGGCGG + Intergenic
1062365226 9:136205164-136205186 CGCGCGGGCGGGGCGGGCAGCGG - Intergenic
1062483527 9:136763265-136763287 CAGGCGGGCGGGGCGGGGGTAGG + Intronic
1062504654 9:136866633-136866655 CACGCGGGCGGAGGGGGCGCGGG + Intronic
1062543982 9:137053687-137053709 TACGCGGAGGGGGCGGGGGGCGG - Intronic
1203470589 Un_GL000220v1:113961-113983 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203478410 Un_GL000220v1:157933-157955 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203362011 Un_KI270442v1:223983-224005 TACGGGGGGGGGGAGGGGGGTGG + Intergenic
1186552441 X:10521115-10521137 TATGGGAGGGGGGCGGGCGGTGG + Intronic
1187332655 X:18354732-18354754 CACGCGGGCCGGCCGCGCGGGGG - Intergenic
1188242644 X:27809485-27809507 GGGGCGGGCGGGGCGGGGGGGGG - Intronic
1188242663 X:27809510-27809532 GGCGGGGGGGGGGCGGGCGGGGG - Intronic
1189323075 X:40097813-40097835 TAGGCGGGCGGCGGCGGCGGAGG - Intronic
1189336777 X:40175265-40175287 TACGCGCGCGGGGCCAGCCGGGG - Intronic
1189518811 X:41744110-41744132 TTTGCGGGGGGTGCGGGCGGCGG - Intronic
1190319478 X:49171832-49171854 GACGCGGGCGGGGCCGGAGCCGG - Intergenic
1190368161 X:49717001-49717023 TACGGGGGCGGGGGGGGAGGGGG - Intergenic
1190885788 X:54530150-54530172 TCCGCGGGGGGGGGGGGGGGGGG - Intergenic
1194704607 X:97160092-97160114 GACGGGGGCGGGGCGGGGTGGGG + Intronic
1196707340 X:118727684-118727706 TGCGCCGGCGGCGGGGGCGGGGG + Exonic
1196804965 X:119575176-119575198 TAGGGGGGCGGGGCGGGGAGTGG + Intronic
1198177704 X:134172542-134172564 TGTGCGGGCCGGGTGGGCGGGGG - Intergenic
1198205321 X:134460092-134460114 CGCGCGGGCGGGGCCGGGGGCGG + Intergenic
1198211391 X:134519615-134519637 GTCGGGGGCGGGGCGGGTGGTGG - Intronic
1199772622 X:150984104-150984126 GAGGCGGGCGGAGCGGTCGGCGG + Intronic
1199772740 X:150984405-150984427 CGCGCGGCCGGCGCGGGCGGCGG - Intronic
1199798673 X:151227929-151227951 AGCGCAGTCGGGGCGGGCGGCGG - Intergenic
1200107681 X:153724129-153724151 CTCGGGGGCGGGGCGGGGGGCGG - Intronic
1200107841 X:153724586-153724608 CACGCGGGCGGGGCGGGGCGGGG + Intronic