ID: 1180831483

View in Genome Browser
Species Human (GRCh38)
Location 22:18909193-18909215
Sequence CTGTAGGCACAGCTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 3, 2: 31, 3: 85, 4: 450}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180831479_1180831483 2 Left 1180831479 22:18909168-18909190 CCAAGAAACAGGAGATTGGGGAA 0: 2
1: 0
2: 2
3: 28
4: 287
Right 1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG 0: 1
1: 3
2: 31
3: 85
4: 450
1180831474_1180831483 27 Left 1180831474 22:18909143-18909165 CCATCGTCGAGGTGTGTACAGAA 0: 3
1: 0
2: 1
3: 0
4: 40
Right 1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG 0: 1
1: 3
2: 31
3: 85
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180831483 Original CRISPR CTGTAGGCACAGCTGGAGCC AGG Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900531647 1:3156742-3156764 CTGTGGCCACTGCTTGAGCCGGG - Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900804716 1:4759877-4759899 CTCCATCCACAGCTGGAGCCTGG - Intronic
900963878 1:5944207-5944229 CTGTAAGCACAGCTGAAAACAGG - Intronic
901647120 1:10722808-10722830 CTCTAGGAAGAGCTGGCGCCAGG + Intronic
901715256 1:11148550-11148572 CTTTAGGCATAGCTGGATGCAGG + Intronic
902200517 1:14830123-14830145 CTTCAGGCACAGCTGGATCCAGG + Intronic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
902592811 1:17487246-17487268 CGGTGGGGACAGCTTGAGCCTGG - Intergenic
903016183 1:20363622-20363644 CAGTAGGAGCAGCTGGAACCTGG - Intergenic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG + Intergenic
903813173 1:26046051-26046073 CTGCAGCCGCAGCGGGAGCCGGG - Exonic
904046921 1:27614731-27614753 CTGGAGGCACAGCTGATGCAGGG + Intronic
904205116 1:28849283-28849305 CTGTTGGCAGAGCTGGAGAAAGG - Intronic
904588237 1:31592125-31592147 GTCCAGGCACAGCTGGAACCAGG + Intergenic
904786690 1:32988214-32988236 TTGTATACATAGCTGGAGCCTGG - Intergenic
905258216 1:36699246-36699268 ATGTAGGGACATCTGGTGCCTGG + Intergenic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906137429 1:43509180-43509202 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
908797159 1:67841974-67841996 CTGCAGGTAGAGTTGGAGCCAGG - Intergenic
911192575 1:94962504-94962526 CTGAAGGTACTGCAGGAGCCAGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
914334473 1:146701921-146701943 CTTCAGGCACAGCTTGATCCAGG + Intergenic
914846483 1:151286587-151286609 CTGGAGGCTCAGCAGGAGACGGG + Exonic
915086670 1:153394004-153394026 CTTTGGGGACAGCAGGAGCCAGG + Intergenic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
919723855 1:200869561-200869583 CTCTCTGCACTGCTGGAGCCAGG - Intergenic
920106722 1:203558573-203558595 CTCCAGGCACAGCTAGATCCAGG + Intergenic
920264745 1:204713439-204713461 CTGTAGGCACACCTGTGCCCAGG - Intergenic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
922414045 1:225403928-225403950 CTGGAGGTACTGGTGGAGCCAGG - Intronic
922730433 1:227946527-227946549 CCGTACCCACAGTTGGAGCCAGG + Intronic
922899120 1:229122771-229122793 CTGCAGTCAAAGCAGGAGCCAGG + Intergenic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
924486564 1:244489517-244489539 CTGAAGAGACAGCTGGAGTCAGG + Intronic
1063293557 10:4777484-4777506 CTGTAGTCCCAGCTATAGCCTGG - Intergenic
1064261232 10:13788136-13788158 CTGGAGGGACTGCTGGTGCCAGG + Intronic
1067080689 10:43210746-43210768 ATGTAGGCACAGACGGGGCCGGG + Intronic
1067249196 10:44573083-44573105 CTGCAGGCATAGCTGGATCCAGG - Intergenic
1067267452 10:44757691-44757713 CTCAGGGCACAGCTGCAGCCTGG + Intergenic
1067308605 10:45091461-45091483 CAGTGGGCTCTGCTGGAGCCGGG - Intergenic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069510376 10:69037706-69037728 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
1070539334 10:77404972-77404994 TTTCAGGCACAGCTGGATCCGGG - Intronic
1070915109 10:80148495-80148517 CTTTGGGCCCAGCTGGGGCCTGG + Intergenic
1071157316 10:82706032-82706054 CTGTAGGGACAGCTCCAACCTGG + Intronic
1071727667 10:88216333-88216355 CTTCAGGCACAGCTGGATCTAGG + Intergenic
1071879340 10:89878070-89878092 CTCTTGCCACAGCTGGACCCTGG - Intergenic
1072247017 10:93552777-93552799 CTTTAGGCACATCTGGATCCAGG - Intergenic
1073242377 10:102066876-102066898 CTGAAGGCCCAGCTGGTGGCTGG + Exonic
1074043940 10:109819731-109819753 CTATAGGCAGAGCTGGAACTAGG + Intergenic
1074369563 10:112888958-112888980 CTTCAGGCACAGCTGTATCCAGG - Intergenic
1074550745 10:114439895-114439917 CTGCAGGGACAGCTTGACCCAGG + Intronic
1075024078 10:118970960-118970982 GGGTAGGCACAGCTGTGGCCAGG - Intergenic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075129147 10:119723902-119723924 GGGTAGGCACAGCTCTAGCCTGG - Intergenic
1075674462 10:124286787-124286809 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1076419979 10:130324437-130324459 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1076712436 10:132345754-132345776 CGTCAGGCACAGCCGGAGCCAGG + Intronic
1076721251 10:132394314-132394336 CTGTAGGCACAGCCGCAGCAAGG - Intergenic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1076882306 10:133245511-133245533 ATGCAGGCACGGCTGGATCCAGG - Intergenic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077475932 11:2790487-2790509 CTGTGTGCACAGCTGGATGCTGG - Intronic
1079058717 11:17229124-17229146 TTGTAGCCACAGCTAGAGCCTGG - Intronic
1079690098 11:23406641-23406663 CTGTGGGGCCCGCTGGAGCCTGG + Intergenic
1080640524 11:34155796-34155818 CTGCAGCCCCTGCTGGAGCCTGG + Intronic
1080770887 11:35340293-35340315 ATCTGGGCACTGCTGGAGCCAGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1083633927 11:64109866-64109888 CGGAAGGCACAGCAGGAGCAGGG + Intronic
1083706014 11:64516343-64516365 CTGCAGGAACTGCTGCAGCCAGG + Intergenic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1084910160 11:72381712-72381734 CTGTGGGCTGGGCTGGAGCCTGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1085769679 11:79313722-79313744 CTGTTGTCACTGCTGGAGCTCGG - Intronic
1089101412 11:115965736-115965758 CAGTAGGTAGAACTGGAGCCCGG + Intergenic
1089146748 11:116335038-116335060 CTGTAGGCTCTGCTGGGGCGAGG - Intergenic
1089185572 11:116612436-116612458 CTGTGGGGAGAGCTGGAGACAGG + Intergenic
1089487392 11:118857533-118857555 CTGTAGTCCCAGCTTAAGCCTGG - Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1089751433 11:120654154-120654176 CTGTAGTCAAAGCAGGGGCCTGG + Intronic
1089834050 11:121354370-121354392 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1090556704 11:127884035-127884057 CTATATGCAAAGCTGAAGCCTGG - Intergenic
1092936303 12:13367254-13367276 CTGTAGGGCCAGGTGGGGCCTGG - Intergenic
1093090769 12:14917753-14917775 CTGAAGGCTCAACTGGAGCTGGG - Intronic
1097824136 12:64157221-64157243 CTGTAGGAAGAGCTGAAGCAGGG + Exonic
1097899186 12:64856691-64856713 CTCTAGACACACCTGGGGCCTGG - Intronic
1098146416 12:67502314-67502336 CTGTGAGCTCAGCTGGACCCTGG + Intergenic
1100019067 12:90047919-90047941 CTTTAGGCACAGATGGCTCCAGG - Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101565021 12:105896893-105896915 CTGTAGGACCAGGTTGAGCCTGG + Intergenic
1101970102 12:109307059-109307081 CTGTGTGCAGAGCTGGGGCCAGG - Intronic
1102175894 12:110874528-110874550 CTTCAGGCATAGCTGGATCCAGG + Intronic
1102525177 12:113507522-113507544 CTTCAGGCACAGTTGGATCCAGG + Intergenic
1102532901 12:113559847-113559869 CTGTAGTCCCAGCTCCAGCCTGG - Intergenic
1102542573 12:113633202-113633224 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1102560381 12:113757815-113757837 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1102651772 12:114447516-114447538 CTCTAGGCGCAGCTGGACCGGGG + Intergenic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1103845692 12:123900710-123900732 CTTCAGGCACAGCTGGATCTAGG + Intronic
1103975965 12:124702944-124702966 CTTCAGGTACAGCTGGATCCAGG + Intergenic
1103979266 12:124726021-124726043 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1103982286 12:124744426-124744448 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1104265403 12:127227689-127227711 CTGCAGGCATAGCTGTATCCAGG - Intergenic
1104377415 12:128277259-128277281 CTTCAGGCACAGCTGGATCCAGG + Intronic
1104434515 12:128745178-128745200 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104517978 12:129445613-129445635 CTTCAGGCACAGCTGGATCCAGG - Intronic
1104597741 12:130131640-130131662 GTGTGGGCACAGATGGTGCCAGG - Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104792731 12:131493932-131493954 CTGCAGGCTCGGCTGGATCCAGG - Intergenic
1104962279 12:132493905-132493927 CTGCAGGCACACCCTGAGCCAGG - Intronic
1105294601 13:19076701-19076723 AAGCAGGCACAGCTGGTGCCAGG - Intergenic
1106016322 13:25872402-25872424 CTTCAGGCAGAGCTGGATCCAGG - Intronic
1106138799 13:26993708-26993730 CTGCAGGGACAGCTTTAGCCAGG - Intergenic
1107903355 13:45040121-45040143 CTTTAGGCACAACTGGATCTGGG + Intergenic
1108531381 13:51330364-51330386 CTTTAGTCAAAGCTAGAGCCTGG - Intergenic
1108588778 13:51894223-51894245 CTGCAGGCACAACTGGATTCAGG + Intergenic
1111919417 13:94394831-94394853 CAGTAGGCACAGTTAGAGGCTGG + Intronic
1112733730 13:102394843-102394865 CTGGAGGCAGAGCTGCAGCGTGG + Intronic
1113812968 13:113153490-113153512 CAGCAGGCACAGCTGGGTCCAGG + Intergenic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116938820 14:50770184-50770206 CTGTGAGCAAAGCAGGAGCCTGG + Intronic
1117531027 14:56661012-56661034 CTGAAGGAAAAGCTGGAGGCGGG + Intronic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1118688849 14:68318683-68318705 CTCTAGCTACAGCTGCAGCCTGG - Intronic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119531431 14:75364064-75364086 CTTTAGGAACAGCTGGATCCAGG + Intergenic
1119608943 14:76045567-76045589 CTGTAGGCACCCCCAGAGCCAGG + Intronic
1119683670 14:76612890-76612912 ATTCAGGCACAGCTGGATCCGGG + Intergenic
1120178585 14:81320768-81320790 CTGTAGGCACATCCTAAGCCAGG - Intronic
1121432429 14:93897297-93897319 CTGCAGGTACAGCTGGCTCCAGG - Intergenic
1121484849 14:94306610-94306632 TTAGTGGCACAGCTGGAGCCAGG - Intronic
1121638300 14:95468422-95468444 CTGGAGGCTCAGCTGGGCCCTGG - Intronic
1122605386 14:102944606-102944628 CTGTGTGCACAGCCTGAGCCCGG + Intronic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1123627393 15:22237230-22237252 CTTCAGGCACAACTGGATCCAGG - Intergenic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1124648852 15:31460256-31460278 CTGTAGTCCCAGCTGGTGGCGGG - Intergenic
1125492113 15:40155924-40155946 CTATAGCCCCAGCAGGAGCCTGG - Intergenic
1126621379 15:50643365-50643387 CTGCAGTTACAACTGGAGCCTGG - Exonic
1128331319 15:66757490-66757512 CTGGAGGCAGAGCTGAACCCAGG + Intronic
1128388138 15:67165107-67165129 CTGTGGGGACAGCAGGTGCCAGG + Intronic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1129152089 15:73695750-73695772 CTTCAGGCATAGCTGGATCCAGG + Intronic
1129195777 15:73965363-73965385 CTGGAGGCAGAGGGGGAGCCGGG - Intergenic
1129234187 15:74214023-74214045 CTCTAGGCAGAGCTGAATCCTGG - Intergenic
1129276365 15:74448352-74448374 TTCTAGGAACAGCTGGAGCATGG - Intronic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1131063167 15:89416872-89416894 TTGTACGCACACCTGCAGCCCGG - Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131541580 15:93279541-93279563 CAGGAGCCAAAGCTGGAGCCTGG + Intergenic
1132215318 15:100057878-100057900 CTTCAGGCACTGCTGGATCCAGG - Intronic
1132270636 15:100520808-100520830 CAGCAAGCACAGCTGGTGCCGGG + Intronic
1132411300 15:101579988-101580010 CTTCAGGCATAGCTGGACCCAGG + Intergenic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1133431461 16:5740610-5740632 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1133661398 16:7921450-7921472 CTTAAGGTACAGCTGGATCCAGG - Intergenic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1134037384 16:11041420-11041442 CTTCAGGCAAAGCTGGATCCAGG + Intronic
1134108418 16:11499727-11499749 GTGAAGACACAGCTGGTGCCAGG - Intronic
1134410712 16:14001263-14001285 CTTCGGGCACAGCTGGATCCAGG + Intergenic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1135048843 16:19176091-19176113 CTTCAGGCATAGCTGGATCCAGG + Intronic
1135479228 16:22807824-22807846 CTTTAGGCAAAACTGGATCCAGG + Intergenic
1135806113 16:25544454-25544476 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1136084606 16:27875949-27875971 CTTCAGGCACAGCTGCATCCAGG - Intronic
1136086040 16:27885775-27885797 CTTCAGGAACAGCTGGAACCAGG - Intronic
1136141655 16:28292593-28292615 CTGGAGCCGCAGCCGGAGCCCGG + Exonic
1137451329 16:48577529-48577551 TTGCAGCCACAGCTGCAGCCTGG + Intronic
1137620102 16:49870497-49870519 CTGTCAGGACAGCTGGACCCTGG - Intergenic
1138346128 16:56321315-56321337 CTGCAGGCGCAGCTGGATCCAGG + Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1138388016 16:56649333-56649355 CTGGAGGCAGGGCTTGAGCCAGG + Intronic
1138393044 16:56683867-56683889 CTGGAGGCAGGGCTCGAGCCAGG + Intronic
1138447285 16:57072099-57072121 CTTCAGGCACAGCTGGATCCAGG + Intronic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1138600738 16:58052400-58052422 CTTTAGGCACGGCTGGATCCAGG - Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1139999148 16:71009311-71009333 CTTCAGGCACAGCTTGATCCAGG - Intronic
1140503820 16:75457196-75457218 CTCAAGGCACTGCTGGAGCCTGG + Intronic
1140855071 16:78970848-78970870 CTTCAGGCACGGCTGGATCCAGG + Intronic
1141260446 16:82448840-82448862 CAGTAAGCACGGCTGGAGCAGGG - Intergenic
1141293943 16:82749236-82749258 CTTTAGGTACAGCTGGATCCAGG - Intronic
1142124806 16:88404968-88404990 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1142155871 16:88532708-88532730 CGGTAGGCACCGCAGGGGCCGGG + Exonic
1143606363 17:7988705-7988727 CTTCAGGCACAGCTGGATTCAGG - Intergenic
1143606815 17:7991705-7991727 CTTCAGGCACAGCTGGATTCAGG + Intergenic
1143796748 17:9343069-9343091 TGGTAAGGACAGCTGGAGCCAGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144046749 17:11460833-11460855 CTGTAGGCTCAGCTAGGCCCTGG - Intronic
1144144836 17:12387472-12387494 GTCTGGGCACAGGTGGAGCCTGG + Intergenic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1146168056 17:30607213-30607235 TTTTAGGCACAGCTAGATCCCGG + Intergenic
1146221027 17:31020710-31020732 TTTTAGGCACAGCTGGATCCCGG + Intergenic
1146636629 17:34511251-34511273 CTTCAGGCACATCTGGATCCAGG + Intergenic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1147589050 17:41669525-41669547 CTCTAGGCCCAGCTGGGGGCTGG + Intergenic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1148977470 17:51542171-51542193 CTGTAGGCAGCCCTGGAGCATGG + Intergenic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1149368525 17:55969447-55969469 CTGTTGGCTCTGCAGGAGCCTGG + Intergenic
1149993521 17:61395702-61395724 GAGGCGGCACAGCTGGAGCCCGG + Intergenic
1150366726 17:64594425-64594447 TTTTAGGCACAGCTGGATCCCGG - Intronic
1151348202 17:73516201-73516223 TGGTAGAGACAGCTGGAGCCTGG + Intronic
1151582304 17:74987537-74987559 ATGTATGCAAAGCTGGAGGCGGG - Intergenic
1151625374 17:75272421-75272443 GTGAGGGCACAGCTGGTGCCTGG - Intergenic
1151750186 17:76032746-76032768 CTCTAGGCCCAGCTGGAGGAGGG - Intergenic
1151816490 17:76473867-76473889 ATGTGGGCACCGCTGGAGGCTGG + Exonic
1152413791 17:80146200-80146222 CAGAAGGAACAGCTGGTGCCAGG - Intronic
1152823228 17:82447726-82447748 CTGTAGGAACAGCTGTGGTCAGG + Intronic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1153864009 18:9245421-9245443 CTGTAGCCCCAGCTGGAGAGTGG - Intronic
1153925454 18:9831666-9831688 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1157876231 18:51276227-51276249 CTGTCGGCTCAGCTGGGGCCAGG + Intergenic
1157905728 18:51568291-51568313 CTTCAGGCATGGCTGGAGCCAGG + Intergenic
1158189768 18:54813568-54813590 CAGAAGGCAGAGCAGGAGCCAGG - Intronic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160423734 18:78766782-78766804 CTTTAGGGACAGCTCCAGCCTGG - Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160678507 19:402964-402986 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1160737577 19:671018-671040 GTTCAGGCACAGCTGGATCCAGG + Intergenic
1160742080 19:691148-691170 TTGTAACCACAGCTGGAGCCGGG - Intronic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1160926989 19:1551259-1551281 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1160938169 19:1607454-1607476 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1160987701 19:1847038-1847060 CTGTAGGCACAGCTGTCGGCAGG + Intronic
1161302225 19:3548201-3548223 CTGCAGGTGCAGCAGGAGCCAGG + Exonic
1161378126 19:3950471-3950493 CTGTGGGCCCAGCTAGGGCCTGG + Intergenic
1161455179 19:4366376-4366398 CTTCAGGCACAGCTGGATCCCGG - Intronic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1162055068 19:8057725-8057747 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1162496879 19:11028313-11028335 CTTCAGGCACAGCTGGATCCAGG + Intronic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1162882234 19:13668305-13668327 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1162925642 19:13929618-13929640 CAGAGGGCACAGCTGGAGCAGGG + Exonic
1162928368 19:13942223-13942245 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163183338 19:15619110-15619132 CTTCAGGCACAACTGGATCCAGG + Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1163654137 19:18535872-18535894 CTTCAGGCATAGCTGGATCCAGG - Intronic
1163668893 19:18616237-18616259 CTTCAGGCACAGCTGGATCCAGG + Intronic
1164678764 19:30120238-30120260 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1164931818 19:32181794-32181816 CAGTAGGCAAAGCTGCAGACCGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165805417 19:38577873-38577895 GTGTAGACACAGCTGGAGTGTGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166697857 19:44864222-44864244 CTGTAGTCCCAGCTTGAACCTGG + Intronic
1166916018 19:46196571-46196593 CTGGAGGCTCAGCTGGGGTCGGG - Intergenic
1166983880 19:46648678-46648700 CTGGAGGCAGAGCTGAAGGCAGG + Exonic
1167090737 19:47341866-47341888 CTTCAGGCATAGCTGGATCCAGG + Exonic
1167097180 19:47380734-47380756 CTTCAGGCACAGCTGGATCCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167249165 19:48391526-48391548 CTGGCGGCGGAGCTGGAGCCGGG + Exonic
1167311145 19:48738783-48738805 CTCTAGGCAGAGCTAGAGCAGGG - Intronic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1167745830 19:51351360-51351382 CTTCAGGCACAGCTTGATCCAGG - Intronic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1168244824 19:55107053-55107075 CTCTAGGCATAGCTTGATCCAGG - Intronic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
927081114 2:19631473-19631495 CTTCAGGAACAGCTGGAACCAGG - Intergenic
927200226 2:20573554-20573576 CTGTTGGCCCAGCCCGAGCCAGG - Intronic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
927851953 2:26504859-26504881 CTGTAGGTCCAGGTGGAGCCAGG + Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
928914908 2:36460134-36460156 ATGTAACCACAGCTGCAGCCAGG - Intronic
929050017 2:37828487-37828509 CAGTGGGGACAGCTGAAGCCGGG + Intergenic
929237174 2:39617758-39617780 GTTTAGGTACAGCTGGATCCAGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
932589893 2:73059026-73059048 CTGGAGGCAGAGCTGGACCTTGG - Intronic
933006328 2:77000201-77000223 CTGTGGGGACAGCTGGACACAGG + Intronic
933659636 2:84916638-84916660 TTGTAGCCACATCTGAAGCCTGG - Intergenic
935865825 2:107386679-107386701 CTGAAGGAACAGCTGGATGCTGG - Intergenic
936953848 2:118004742-118004764 CTGTGGGCAAAGCTGGAGACGGG - Intronic
937124586 2:119465372-119465394 CTGTAGGCATGGCTGGATCTAGG - Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938238614 2:129725571-129725593 GAGTAGGCACTGCAGGAGCCAGG - Intergenic
941936968 2:170989762-170989784 CTGTAGTCCCAGCTTGAGCCCGG + Intergenic
942764881 2:179443318-179443340 CTGGAGGAATGGCTGGAGCCTGG + Exonic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
944644388 2:201763549-201763571 TTGTAGCCACAGCTAGAGCCTGG - Intronic
946232209 2:218298692-218298714 GTAAGGGCACAGCTGGAGCCTGG - Intronic
946488022 2:220119663-220119685 TTGTTGTCACAGCTGGAGACAGG + Intergenic
946804041 2:223452042-223452064 CTGCAGGCAGAGCTGGCGCAGGG + Intergenic
946815115 2:223569128-223569150 CTGTATTCACATGTGGAGCCTGG - Intergenic
947436347 2:230075992-230076014 ATGTAGGCCCAGCTGGGGACTGG - Intergenic
947531270 2:230910027-230910049 CTGCAGGACCAGCTGGACCCTGG + Exonic
947820252 2:233064128-233064150 CTGCAGGAGCAGCTGGGGCCCGG + Intronic
948108063 2:235430899-235430921 CTTCAGGAACAGCTGGATCCAGG - Intergenic
948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG + Intergenic
948460963 2:238129801-238129823 CTGTAGCCACAGGTGGCTCCTGG + Intronic
948772125 2:240256997-240257019 TTTCAGGCACAGCTGGATCCAGG + Intergenic
948787097 2:240358441-240358463 GTCTAGGCAGGGCTGGAGCCTGG - Intergenic
948826240 2:240574607-240574629 CTGCAGGTCAAGCTGGAGCCAGG + Exonic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1170436132 20:16331106-16331128 CTGAATGCATAGCTGGACCCAGG + Intronic
1170613819 20:17933892-17933914 CTGTGTGCATAGCTGCAGCCAGG + Intergenic
1171456320 20:25274742-25274764 CTGCGGGCAAGGCTGGAGCCAGG + Intronic
1171879181 20:30604045-30604067 AAGCAGGCACAGCTGGTGCCAGG - Intergenic
1172102697 20:32495069-32495091 CAGTACGCACAGCAGGTGCCTGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172630187 20:36373251-36373273 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1172771583 20:37385398-37385420 CTGTCTGCACCGCTGGGGCCCGG - Intronic
1173942320 20:46921779-46921801 CTTCAGGAACAGCTGGATCCAGG - Intronic
1174078516 20:47954733-47954755 CTACAGGCACAGCTGGATCTTGG - Intergenic
1174113667 20:48212989-48213011 CTTCAGGCACAGCTGCATCCAGG + Intergenic
1174168188 20:48599552-48599574 CTTCAGGCACAGCTGCATCCAGG - Intergenic
1174323753 20:49762664-49762686 CTGTAGGCAGAGCAGCAGCATGG + Intergenic
1174419604 20:50391037-50391059 CTGAAGGCAGAGCTGGAACTGGG + Intergenic
1174734065 20:52947584-52947606 CTTTGGGCATAGCTGGATCCAGG - Intergenic
1175118195 20:56698699-56698721 CTTCAGGTACAGCTGGATCCGGG + Intergenic
1175122322 20:56725276-56725298 CTTCAGGCACGGCTGGATCCAGG + Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1175228460 20:57459163-57459185 CTTCAGGCACAGATGGATCCAGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175677823 20:60961914-60961936 CTTTAGGCTCGGCTGGATCCAGG + Intergenic
1175794051 20:61760351-61760373 CTGTGGGCAAAGCCGGAGCCTGG - Intronic
1175831335 20:61966678-61966700 CTTCAGGCACGGCTGGATCCAGG + Intronic
1175983152 20:62751452-62751474 CTGCAGGCGCAGCTTGACCCAGG + Intronic
1176119806 20:63449200-63449222 CTTCAGGCACAGCTGGATCCAGG - Intronic
1176300267 21:5095934-5095956 CTGTGGGCACACCCGGACCCTGG + Intergenic
1176386857 21:6142386-6142408 CTGCAGGCATGGCTGGATCCAGG + Intergenic
1176423551 21:6534003-6534025 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1178901952 21:36605600-36605622 CAGTGGCCCCAGCTGGAGCCAGG + Intergenic
1179649039 21:42794721-42794743 CTGCAGGCACAGCTGAAAGCTGG + Intergenic
1179699045 21:43142319-43142341 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1179736616 21:43395866-43395888 CTGCAGGCATGGCTGGATCCAGG - Intergenic
1179856755 21:44165977-44165999 CTGTGGGCACACCCGGACCCTGG - Intergenic
1179867348 21:44225415-44225437 CTGCATGGACAGCTGCAGCCTGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181149130 22:20870221-20870243 CAGTGGGCACATCTGGAGACGGG - Intronic
1181855327 22:25777460-25777482 CTGGAGGCAGATCTGGAGGCAGG + Intronic
1182756547 22:32684364-32684386 CTTCAGGCACAGCTGGATCTAGG - Intronic
1182905609 22:33933402-33933424 CTGTAGAAACTGCAGGAGCCTGG - Intergenic
1183232934 22:36594088-36594110 CTTCAGGCACAGATGGATCCAGG + Intronic
1183299932 22:37053851-37053873 CTGTTAGCAGAGCTGCAGCCAGG + Intronic
1183333610 22:37234467-37234489 CCGGAGGCACAGCTGTGGCCTGG - Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184825143 22:46945535-46945557 CCGTCAGCACAGCTGCAGCCTGG - Intronic
1185173596 22:49306971-49306993 CTCTGTGCAGAGCTGGAGCCGGG - Intergenic
1185242575 22:49754613-49754635 CACTGGGCACAGCTGGGGCCTGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949876078 3:8626855-8626877 CTTCAGGCCCAGCTGGATCCGGG - Intronic
949921821 3:9009049-9009071 CTTCAGGCACAGCTGGATCCAGG - Intronic
950047814 3:9960879-9960901 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
950132761 3:10558578-10558600 CTTCAGGCACAGCTGGATCCAGG - Intronic
950420362 3:12895258-12895280 CTGTTGGCAAAGCTGGAGTGTGG - Intergenic
950493299 3:13319111-13319133 CTGCAGGCACAGCAAGATCCCGG + Exonic
950526645 3:13528350-13528372 CTGAAGGCACAGCTGAAGTAGGG + Intergenic
950719853 3:14875175-14875197 CTGAAGTCACATCTGGAGACGGG - Intronic
951864610 3:27294264-27294286 GTGCAGGCACAGCTGCAGGCTGG - Intronic
952968054 3:38633131-38633153 CTGCAGGTCCAGCTGGGGCCGGG + Exonic
953373833 3:42412214-42412236 GTGTTGGCTCAGCTGGAGGCTGG + Intergenic
953449105 3:42991598-42991620 GTCTGGGCACAGCTTGAGCCTGG - Intronic
954317672 3:49810129-49810151 CTGAAGCCACTGCTGGAGGCAGG - Exonic
954805849 3:53220018-53220040 CAGGAGGCACTGCTGCAGCCAGG + Intergenic
955195632 3:56802294-56802316 CTGTAGTGACACCTGGAGGCAGG + Intronic
955352003 3:58200494-58200516 CTTCAGGCATAGCTGGATCCAGG - Intronic
955511484 3:59685327-59685349 CTTCAGGCACAGATGGATCCAGG + Intergenic
955527156 3:59832911-59832933 CTTCAGGCACAGCTGGATTCAGG - Intronic
955999061 3:64709439-64709461 CTTCAGGCACAGTTGGATCCAGG + Intergenic
956642579 3:71428883-71428905 CAGGAGGCACTGCTGAAGCCGGG + Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
956663720 3:71622918-71622940 ATGGAGGCAGAGATGGAGCCAGG + Intergenic
956668623 3:71664966-71664988 CTTCAGGCACAGCTTGATCCAGG - Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
960966661 3:123110386-123110408 GTGGTGGCAGAGCTGGAGCCTGG + Intronic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
961515315 3:127428752-127428774 CTTCAGGCACAGCTGGATCCAGG + Intergenic
961517655 3:127448209-127448231 CTTCTGGCACAGCTGGATCCAGG + Intergenic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
961651060 3:128416860-128416882 CTCCAGGCATAGCTGGATCCAGG - Intergenic
961741285 3:129034580-129034602 CTTCAGGCACAGCTGGGTCCAGG + Intronic
962306133 3:134287990-134288012 CTGAAGGCAAATCTGGAGCTCGG - Intergenic
968540229 4:1164585-1164607 CTGTAGGCCCAGCAGCACCCTGG + Intergenic
968962113 4:3750918-3750940 ATCCAGTCACAGCTGGAGCCAGG + Intergenic
969245152 4:5927152-5927174 CTCCAGGCACAGCTGGCTCCAGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969298500 4:6283452-6283474 CTTCAGGCACGGCTGGATCCAGG + Intronic
971042324 4:22767491-22767513 TTGTAGGCACAGCTGTTGTCTGG + Intergenic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973624407 4:52757017-52757039 CTGTAAGAACACCTGGATCCTGG + Intergenic
974878501 4:67725348-67725370 CTGCAGTCATAGCTGAAGCCTGG - Intergenic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
975599765 4:76086996-76087018 CTGTCAGCCCAGCTGCAGCCGGG - Intronic
975618334 4:76270108-76270130 CTTCAGGCACAGCTGGATCCAGG + Intronic
975723950 4:77274269-77274291 CTGGAGGCTCAACTGGATCCAGG - Intronic
975856200 4:78627268-78627290 CTTTAGGCACAGCTGGATTCAGG + Intergenic
977136496 4:93311198-93311220 CTGAAGAGACAGCTGGAGTCAGG + Intronic
977719553 4:100223823-100223845 CAGTGGGCTCAGCTGAAGCCTGG + Intergenic
979748883 4:124251281-124251303 CTGTATGCTCAGCGGGAACCAGG - Intergenic
980911118 4:138995416-138995438 CTTTAGGAAGAGCTGGAGCTGGG - Intergenic
981035609 4:140165424-140165446 CTTTAGGCTCAGCTGGATCCAGG - Intergenic
981748283 4:148071266-148071288 CTGGAGGGGCGGCTGGAGCCAGG + Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
985561329 5:587675-587697 TTGTGGCCAGAGCTGGAGCCGGG - Intergenic
985948404 5:3204162-3204184 CTTCAGGCACAGCTGTACCCAGG - Intergenic
986198668 5:5561287-5561309 CTGATGGCTCAGCTGGAACCAGG + Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
990818319 5:59809872-59809894 CTCTAGGCAGAGATGGACCCCGG - Intronic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
993970886 5:94418817-94418839 ATGTAGGCATTGCTGGATCCAGG - Intronic
994074620 5:95636646-95636668 CTTCAGGCAGAGCTGGATCCAGG + Intergenic
995732846 5:115264653-115264675 TTGTAGCCACCGCTGGAGCCTGG + Intergenic
995748963 5:115433984-115434006 CTTTAGGCAAGGCTGGATCCAGG + Intergenic
996012257 5:118493985-118494007 CTGTAGGCAGAGCTGGACAATGG - Intergenic
997223151 5:132187066-132187088 CAGTAGGCACCGTTGGAGCTGGG - Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
997726743 5:136127251-136127273 CTTCAGGTACAGCTGGATCCAGG + Intergenic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
998379602 5:141714737-141714759 CTCTAGGCAAAGGAGGAGCCAGG - Intergenic
998765040 5:145477217-145477239 CTTCAGGTACAGCTGGATCCAGG + Intronic
999454483 5:151703334-151703356 CTCTAGGGACAGCTGCAGCAAGG - Intergenic
999667203 5:153925316-153925338 CTTTAGGCATAGCTGGATCCAGG - Intergenic
1000810411 5:165854499-165854521 CTTCAGGCACAGCTAGATCCAGG - Intergenic
1001050661 5:168411524-168411546 CTTCAGGCACAGCTGGATCCAGG + Intronic
1001146625 5:169190374-169190396 CTTCAGGAACAGCTGGATCCAGG - Intronic
1001198762 5:169697186-169697208 CTTCAGGCATAGCTGGATCCAGG + Intronic
1001404093 5:171463377-171463399 CTTCAGGCAAAGCTGGATCCAGG + Intergenic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1001452817 5:171839273-171839295 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1001562196 5:172677097-172677119 CTGTAAGCACACCTTGGGCCGGG + Intronic
1001563725 5:172686424-172686446 CTGTATGCTCAGCTGGAGGGAGG + Intronic
1001757526 5:174182009-174182031 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1002080631 5:176735200-176735222 CTTCAGGCCCAGCTGGATCCAGG - Intergenic
1002082745 5:176747358-176747380 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1002129688 5:177072849-177072871 CTTCAGGCATAGCTGGATCCAGG - Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002487647 5:179550615-179550637 CTGGAGCCGGAGCTGGAGCCGGG + Exonic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1005488320 6:26322444-26322466 CTGTAGCCCCGGCTGGAGTCTGG + Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1007759089 6:44121815-44121837 CTGTAGTCCCAGCTACAGCCCGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1008899187 6:56591831-56591853 CTGTAGTCCCAGCTGGTGGCGGG + Intronic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1011057915 6:83226048-83226070 CTGTAGGCACAGGTGAAGATAGG - Intronic
1013779000 6:113709834-113709856 CTGTAGTCTCAGCTGGAGTGGGG + Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016409829 6:143771347-143771369 CTGTAGTCCCAGCTTGAGCCTGG - Intronic
1016616288 6:146052408-146052430 GTGGAGGCTCTGCTGGAGCCTGG + Intronic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1017117953 6:150996625-150996647 CTGTAGGCTCAGCAGGAACCAGG - Intronic
1017419199 6:154256162-154256184 ATGTGGGCAGAGCTGGTGCCTGG + Intronic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1019176404 6:170161415-170161437 CTTTAGGCATAGCTGCAGCGCGG - Intergenic
1019356904 7:585007-585029 CTTCAGGCACGGCTGGATCCAGG - Intronic
1019516497 7:1442504-1442526 CATCAGGCACAGCTGGATCCAGG + Intronic
1020264917 7:6553871-6553893 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1020728030 7:11841711-11841733 AGGTAGGCAGATCTGGAGCCTGG + Intergenic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1026849438 7:73715913-73715935 GTGTACACACAGCTGGAGGCTGG - Intronic
1028264390 7:88705239-88705261 CTCTGGACCCAGCTGGAGCCTGG - Intergenic
1028364460 7:90011241-90011263 ATTCAGGCACAGCTGGATCCAGG - Intergenic
1029148223 7:98461958-98461980 CTTTAGGCATAGCTGTATCCAGG - Intergenic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1030492040 7:110249448-110249470 CTGTAGGCACCACTGAAGCTTGG - Intergenic
1030533207 7:110735751-110735773 CTGTAGTCCCAGCTTGAGCCTGG + Intronic
1030957756 7:115876552-115876574 ATGCAGTCACTGCTGGAGCCTGG - Intergenic
1031040773 7:116836462-116836484 TTGGAGTCAGAGCTGGAGCCAGG - Intronic
1031163741 7:118201406-118201428 CTTTAGGCATCGCTGGATCCAGG - Intergenic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1032085056 7:128879510-128879532 CTGGAGCCGCACCTGGAGCCCGG + Exonic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1032980295 7:137274206-137274228 CTCTAGGCACAGCTGGGGTAAGG - Intronic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1034263114 7:149769292-149769314 CTGTGGGCCCTGCTGGAGCCAGG - Intronic
1034964914 7:155384881-155384903 CCGTAGACAGAGCAGGAGCCAGG - Intronic
1035204582 7:157286974-157286996 CTGTAGGCAAGGCTGGCACCAGG + Intergenic
1035353837 7:158265426-158265448 CTGTGGGCACACCTGCAGGCAGG + Intronic
1035458237 7:159023428-159023450 CTGTGGGCACAGCCGGGGGCGGG - Intergenic
1035540404 8:431558-431580 CTGTAGGCAATGCTGGATACTGG - Intronic
1036766624 8:11553648-11553670 CTGGGGGCACAGCTGCACCCGGG + Intronic
1036920214 8:12845482-12845504 TGGTAGCCACAGCTGGAGCCTGG + Intergenic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1040550429 8:48433053-48433075 CAGCAGGCACAGCTGCACCCAGG - Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044871865 8:96627654-96627676 CTTCAGGCACAGCTGGATCTTGG + Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1045589282 8:103575844-103575866 CTTTAGGCATATCTGGTGCCAGG - Intronic
1046716514 8:117573757-117573779 CTTCAGGCACAGCTGTAACCAGG - Intergenic
1047502714 8:125454416-125454438 CTGCAGGCAAGGCCGGAGCCTGG - Intergenic
1047607952 8:126493295-126493317 AAGTAGGCACACCTGGATCCAGG - Intergenic
1048491714 8:134900467-134900489 CTTCAGGCACAGCTAGATCCAGG + Intergenic
1048503111 8:134996686-134996708 CTTTAGGCAAAGCTGGATTCCGG + Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049084872 8:140470802-140470824 CTGATGGCAAAGCTGGAGCAGGG - Intergenic
1049479727 8:142816170-142816192 CTGTAGGCCCTGCAGGAGCAAGG - Intergenic
1049641608 8:143718509-143718531 CTGTGGTCAGAGCAGGAGCCTGG - Intronic
1050243086 9:3658788-3658810 CTGCAGTCACTGCTGTAGCCAGG - Intergenic
1050376194 9:4975897-4975919 CAGTAATCACAGCTGCAGCCAGG - Intergenic
1051535644 9:18154414-18154436 CCGTAGGCACAGCTAGAGGCTGG + Intergenic
1051606320 9:18920783-18920805 CTTTAGGCATAGCTGGAACCAGG - Intergenic
1052415138 9:28168178-28168200 CTTTAGGCTCAGCAGGAGTCAGG - Intronic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1052824193 9:33163505-33163527 CTGGGGGCTCAGCTGGGGCCTGG - Intronic
1054458722 9:65450458-65450480 CTGGAGCCAGGGCTGGAGCCAGG + Intergenic
1054769148 9:69068218-69068240 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1056230501 9:84538525-84538547 CTCTAGACCCACCTGGAGCCAGG - Intergenic
1056367768 9:85922865-85922887 CTGGAGGTTCAGGTGGAGCCAGG + Intergenic
1056630130 9:88286657-88286679 CTGTAATCACAGCAGGAGACGGG + Intergenic
1057522353 9:95770087-95770109 CTTCAGGCACAGCTGGATCTAGG - Intergenic
1057792014 9:98130781-98130803 CCCTAGGAACACCTGGAGCCAGG - Intronic
1057891526 9:98873651-98873673 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061207280 9:129172145-129172167 CTTCAGGCACAGCAGGATCCAGG - Intergenic
1061297415 9:129684309-129684331 CTTCAGGCACTGCTGGATCCAGG + Intronic
1061744936 9:132732733-132732755 CTACAGGCACAGCTTGAACCAGG - Intronic
1061883333 9:133578799-133578821 GGGGAGGCACAGCTGGGGCCTGG - Exonic
1062052928 9:134456817-134456839 GGGAAGGCACAGCTGGAGCTCGG - Intergenic
1062401222 9:136373559-136373581 CTGCAGACACACCAGGAGCCTGG + Exonic
1062536546 9:137023617-137023639 CTAAAGGCACAGCTGGTGCCTGG - Intronic
1186615601 X:11184089-11184111 ATTTAGGCACGGCTGGATCCAGG - Intronic
1187474960 X:19602396-19602418 CTGTAAGTACAGCTGGAGAAGGG + Intronic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1189803209 X:44710728-44710750 CTGTGGGCAGTGCTGGATCCTGG + Intergenic
1192129983 X:68540724-68540746 CTTCAGGCACAGCTGGACTCAGG - Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1196981095 X:121214320-121214342 CTGTAGTCCCAGCTTGAACCCGG - Intergenic
1201255785 Y:12107062-12107084 CTATAGGCACAGCAGCAGCTTGG + Intergenic