ID: 1180831497

View in Genome Browser
Species Human (GRCh38)
Location 22:18909251-18909273
Sequence TTCTCTGGTGGCAAGTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 2, 1: 1, 2: 1, 3: 7, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180831497_1180831503 18 Left 1180831497 22:18909251-18909273 CCTGGAGACTTGCCACCAGAGAA 0: 2
1: 1
2: 1
3: 7
4: 149
Right 1180831503 22:18909292-18909314 TCTTCCCAGGAACAGAGTGTTGG 0: 3
1: 0
2: 0
3: 22
4: 225
1180831497_1180831500 -7 Left 1180831497 22:18909251-18909273 CCTGGAGACTTGCCACCAGAGAA 0: 2
1: 1
2: 1
3: 7
4: 149
Right 1180831500 22:18909267-18909289 CAGAGAAGAGCTGCAACATCAGG 0: 3
1: 0
2: 0
3: 25
4: 282
1180831497_1180831501 -6 Left 1180831497 22:18909251-18909273 CCTGGAGACTTGCCACCAGAGAA 0: 2
1: 1
2: 1
3: 7
4: 149
Right 1180831501 22:18909268-18909290 AGAGAAGAGCTGCAACATCAGGG 0: 3
1: 0
2: 1
3: 22
4: 314
1180831497_1180831502 5 Left 1180831497 22:18909251-18909273 CCTGGAGACTTGCCACCAGAGAA 0: 2
1: 1
2: 1
3: 7
4: 149
Right 1180831502 22:18909279-18909301 GCAACATCAGGGCTCTTCCCAGG 0: 3
1: 0
2: 5
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180831497 Original CRISPR TTCTCTGGTGGCAAGTCTCC AGG (reversed) Intronic
900736528 1:4302778-4302800 TTCTCTGGTGACCAGTCCCATGG + Intergenic
900813681 1:4827222-4827244 TACTCTGGTGGCAAAACTGCTGG + Intergenic
901243092 1:7705858-7705880 CTCTCTGGTCGCCAGTCTGCAGG - Intronic
901677332 1:10893342-10893364 TTAAAAGGTGGCAAGTCTCCTGG - Intergenic
904572959 1:31481058-31481080 TTTTGTGGTGGCAAGATTCCTGG + Intergenic
905114607 1:35626948-35626970 GTTTCTGGTGGAAAATCTCCTGG - Intronic
907371560 1:54006799-54006821 TTCTCTGGGGGCTTGGCTCCTGG + Intergenic
908401643 1:63776869-63776891 TTCTCTGGGGTCAAGACTTCTGG + Intronic
910220413 1:84884292-84884314 TACTCTCGTGGCAAGACTGCTGG + Intronic
912810241 1:112788736-112788758 ATCTCAGGTGGCAGCTCTCCAGG + Intergenic
914342544 1:146772721-146772743 TTCACTGGTGGCCAGTCTATGGG + Intergenic
914973340 1:152332011-152332033 TTCTCTCATCGTAAGTCTCCTGG + Intergenic
915251041 1:154588795-154588817 TTATCAGGTGGAAATTCTCCAGG + Intronic
916479501 1:165202265-165202287 TTCTGTGCTAGGAAGTCTCCTGG - Exonic
917622634 1:176812298-176812320 TTCTGTGATGGCAATTCTGCAGG - Intronic
918293697 1:183134933-183134955 TTTTATGCTGGCAAGTCTCAGGG + Intronic
920096945 1:203492469-203492491 TTCTCTGGTGACCAGGCTCTTGG + Intergenic
922199604 1:223390815-223390837 CTGGCTGGTGGCAGGTCTCCTGG + Intergenic
922238654 1:223740348-223740370 TACTCTCGTGGCAAAACTCCTGG - Intronic
922976710 1:229790905-229790927 TTCTCTAGTGGCAAAACTGCTGG + Intergenic
924444771 1:244118983-244119005 TTGTCTGCTGTCAAGTATCCTGG - Intergenic
1063767960 10:9164030-9164052 TTCTCTGGTGGCAAGTGAAGGGG + Intergenic
1064095617 10:12422440-12422462 TTCTCAGGTGGCAATGCCCCAGG - Intronic
1066568196 10:36742849-36742871 TTCTGTGGAGACAAGTCTCTGGG + Intergenic
1069213614 10:65792308-65792330 TACTCTGGTGGCAAAACTGCTGG - Intergenic
1069606880 10:69744311-69744333 GTCTCTGGTGGCAGCTCTCGGGG - Intergenic
1071422607 10:85515732-85515754 TGCTTGTGTGGCAAGTCTCCAGG - Intergenic
1071665961 10:87558775-87558797 TACTCTGGTTGCAAGACTTCAGG + Intergenic
1073415025 10:103373881-103373903 CTCTCTGGTGGGAAGGATCCTGG + Intronic
1076509996 10:131006564-131006586 TTCTGGGGAGGCCAGTCTCCTGG - Intergenic
1076604238 10:131678783-131678805 GTCTCTGGGGGCAACTCTCTCGG - Intergenic
1076850629 10:133090798-133090820 TTCTTTGGTGGCATCGCTCCTGG + Intronic
1077252394 11:1566422-1566444 TGCCCTGGAGTCAAGTCTCCAGG - Intronic
1084697136 11:70762507-70762529 TTTTGTGGTGCCAAGTGTCCGGG + Intronic
1089920921 11:122208930-122208952 GTCTCTGGTGGTCAATCTCCTGG + Intergenic
1094296456 12:28912486-28912508 TCCTCTGGTGGCAAAACTGCAGG + Intergenic
1095866447 12:46978007-46978029 TTGTCTGGGGGAAAGTCTCATGG + Intergenic
1098594867 12:72260395-72260417 TGCTCTGGTGACAAGTTTCTAGG + Intronic
1099231867 12:80035960-80035982 TACTCTGTTGGCAAGTCTATTGG - Intergenic
1100312733 12:93412561-93412583 TACTCTTGTGGCAAAACTCCTGG - Intronic
1103969222 12:124659591-124659613 TTCTCTTCTGCCAAGCCTCCAGG + Intergenic
1104783375 12:131434405-131434427 TTCCCTGGTGGCTGGTGTCCAGG - Intergenic
1106403276 13:29450142-29450164 CTCTCTGGGGGGAAGTGTCCAGG + Intronic
1107404841 13:40102771-40102793 TTCACTGGGAGCAGGTCTCCTGG + Intergenic
1109697788 13:65983488-65983510 TTCTTTGGTGACATGTCTCTGGG + Intergenic
1112486001 13:99820205-99820227 TTGTCAGGTGGCAAGGCACCTGG + Intronic
1117152794 14:52906245-52906267 GTCTCTGGTAGCTAGACTCCAGG - Intronic
1119147333 14:72329354-72329376 CTCCCTGGTGCCAAGTCTCTTGG + Intronic
1123390314 15:19865123-19865145 TTCTGTGGAGACAAGTCTCTAGG + Intergenic
1125156959 15:36598567-36598589 TTATCTGGGGGCAGGTCTCCAGG - Intronic
1125839280 15:42783591-42783613 TTTTCTCGAAGCAAGTCTCCAGG + Exonic
1126540933 15:49822748-49822770 TTCACTGTTGGCAAGGCTGCAGG - Intergenic
1127666886 15:61156515-61156537 TTCTCTGGCGCCATCTCTCCAGG - Intronic
1128389270 15:67172282-67172304 TTCTCTGCTGGCCAGGCTCGGGG - Intronic
1128725998 15:69989088-69989110 CTCCCCGGTGGCATGTCTCCCGG + Intergenic
1128769358 15:70270252-70270274 TTCTTTGGGGGCCAGTCTCCAGG + Intergenic
1129155773 15:73716660-73716682 TCCTCTGGTGACAAGTGCCCTGG + Intergenic
1129612687 15:77072913-77072935 TTCTCTGGGGGCGAGCCTCAGGG + Intronic
1130031766 15:80321251-80321273 TTCACTGGAAGCAAGTCACCAGG + Intergenic
1130307383 15:82722540-82722562 TTTTCTGGGGTCAAATCTCCAGG + Intergenic
1131593049 15:93769571-93769593 TTCTCTGGTCCCAATTCTGCAGG + Intergenic
1139991440 16:70942603-70942625 TTCACTGGTGGCCAGTCTATGGG - Intronic
1140804485 16:78520578-78520600 TTGTCTGGTGGGAAGGCTGCTGG + Intronic
1141170936 16:81691227-81691249 TTCTCTGGAGGCCTCTCTCCTGG + Intronic
1141623016 16:85247161-85247183 TTCTCTGGTCACAAGTGTCCTGG + Intergenic
1142241024 16:88945575-88945597 CTCTCTAGTGGCAAGGCTGCTGG - Intronic
1143498073 17:7323727-7323749 CTCTCTGATCGCCAGTCTCCTGG - Intronic
1144091469 17:11860884-11860906 TTGTCTGGTGAGAAGTCTCGTGG + Intronic
1145112052 17:20172473-20172495 CTCTCAGGGGGCAAGTCTCCTGG + Intronic
1149350821 17:55785075-55785097 TTCTTTAGAGGCAAGTCACCAGG - Intronic
1154531080 18:15345714-15345736 TTCTGTGGAGACAAGTCTCTAGG - Intergenic
1161914482 19:7218285-7218307 CTCTCTGGTGGCAGCTGTCCTGG - Intronic
1164534242 19:29073180-29073202 TTCTGTGGGGGCTGGTCTCCTGG + Intergenic
1166052669 19:40269686-40269708 TTCTCTTGTGGGTAGACTCCTGG - Intronic
926219058 2:10923059-10923081 TGCTTTGGTGGCAAGTGACCAGG + Intergenic
927808613 2:26169703-26169725 TTAACTGTTGTCAAGTCTCCAGG - Intergenic
928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG + Intronic
930584438 2:53252879-53252901 TTCTCAGGTGGGCAGTCTGCTGG - Intergenic
931923947 2:67050842-67050864 GTCTCTGCTGGCAACTCTCTTGG - Intergenic
932627532 2:73309497-73309519 TACCCCGCTGGCAAGTCTCCTGG - Intergenic
933321751 2:80784089-80784111 TTCTCTTGTGCCAGTTCTCCTGG + Intergenic
933719894 2:85391161-85391183 TGCTCTGGAGGCAGGTCTGCGGG - Exonic
936597970 2:113867250-113867272 TTTTCTAGTGCAAAGTCTCCAGG - Intergenic
940009949 2:149041915-149041937 CTCTATGGTGGCAATTCTCAAGG + Intronic
940668387 2:156637321-156637343 TTATCTGGTTTCAAGTCTTCTGG + Intergenic
941080621 2:161056625-161056647 TGCTCTCGTGGCAAGACTGCTGG + Intergenic
947183353 2:227432252-227432274 CTATGTGGTGGCAAGTCTGCAGG - Intergenic
947677175 2:231992770-231992792 TTCCCTGCTGCCAAGCCTCCAGG + Intronic
948897235 2:240933160-240933182 GGCACTGGTGGCCAGTCTCCAGG + Intronic
1168900995 20:1364849-1364871 TTCTCTCGTGGCAAAACTGCTGG + Intronic
1170970769 20:21114510-21114532 TTCTCTGGTGGCTGGCTTCCAGG - Intergenic
1172321685 20:33999847-33999869 TTCTCGGGTGGCACGTGTCTAGG + Intronic
1173135962 20:40439322-40439344 TTCTCTCGTGGCAGTTCCCCTGG + Intergenic
1174603786 20:51745631-51745653 CTCTCTGGTGGGGGGTCTCCTGG - Intronic
1175062471 20:56256195-56256217 TTCTCTGATGGGGAGTCTCTGGG - Intergenic
1175599070 20:60257945-60257967 TTCTCTCCTGGAAAGTCTGCTGG - Intergenic
1176766326 21:13022748-13022770 TTCTGTGGAGACAAGTCTCTAGG + Intergenic
1179619699 21:42605301-42605323 TACTCTTGTGGCAAGACTGCTGG - Intergenic
1180513459 22:16117193-16117215 TTCTGTGGAGACAAGTCTCTAGG + Intergenic
1180831497 22:18909251-18909273 TTCTCTGGTGGCAAGTCTCCAGG - Intronic
1181068186 22:20316390-20316412 TTATCTGGTGGCAAGTCTCCAGG + Intronic
1181068351 22:20317116-20317138 TTCTCTGGTGGCCAGTCCCCAGG + Intronic
1181633200 22:24162164-24162186 TTCTCTGGAGGCCAGCCTCATGG + Intronic
1184386046 22:44175273-44175295 TTTCCTGGTGGCCAGTCTCTGGG + Intronic
1184418837 22:44367699-44367721 TTTAGGGGTGGCAAGTCTCCCGG + Intergenic
1203281581 22_KI270734v1_random:134522-134544 TTCTCTGGTGGCAAGTCTCCAGG - Intergenic
954346466 3:50003933-50003955 TTCTTTGTTGTCAAGTCTCTGGG + Intronic
960258940 3:115543419-115543441 TTTTCTGGTGTTATGTCTCCTGG + Intergenic
961991584 3:131197694-131197716 TTCTCTGGTGGCTAGCCATCTGG + Intronic
962481829 3:135804616-135804638 TTCTCTGTTGTCATGTTTCCAGG - Intergenic
962978812 3:140469573-140469595 TTCTCTGCTCCCCAGTCTCCAGG + Intronic
963516945 3:146320886-146320908 TTCTCTTGTTCCAATTCTCCAGG - Intergenic
963981772 3:151546188-151546210 ATCTCTGTTGGCAAGGCTCAGGG + Intergenic
969411269 4:7029933-7029955 TTCTCAGGTGGCAGGCTTCCTGG + Intronic
970453057 4:16191095-16191117 ACCTCTGGTGGCAAGCCTGCAGG - Intronic
980346731 4:131632220-131632242 TTCTCTGATTGTAAGTTTCCTGG + Intergenic
980452965 4:132998989-132999011 TTCTCTGGTGCTAATTCTGCAGG - Intergenic
982422583 4:155214467-155214489 TGCCCTGCTGGCAAGTCCCCTGG + Exonic
982503845 4:156193980-156194002 TGCTCTGGTGGCACTACTCCAGG + Intergenic
986161064 5:5229454-5229476 TACTCTGGTGGCAAAACTGCTGG + Intronic
988112515 5:26841022-26841044 TTCACTGGTGGCCAGGTTCCTGG + Intergenic
989583779 5:43058392-43058414 TTCTCTGGTCTCAAGTACCCAGG + Intergenic
989620533 5:43379688-43379710 TTATCAGGTGGCAGGTGTCCTGG - Exonic
990579904 5:57157903-57157925 TACTCTTGTGGCAAGACTGCTGG - Intergenic
992726384 5:79612099-79612121 TTCTCTGGGGACAAGTCACTCGG + Intronic
993679651 5:90860189-90860211 TTATCTGGAGGCTAGTCTCCTGG + Intronic
996138193 5:119871171-119871193 TTCACTGTTGGCATGTCTCTAGG - Intergenic
998474038 5:142406120-142406142 TCCTCTGGGGGCAGCTCTCCTGG + Intergenic
1002618318 5:180469008-180469030 ATCTCTGGTGGCTTGTCACCAGG - Intergenic
1003677254 6:8216663-8216685 TTCTCTGATGGCCAGTTTACTGG - Intergenic
1006058373 6:31402391-31402413 TTCTCTGGTGACATCTCCCCAGG - Intronic
1006070811 6:31496935-31496957 TTCTCTGGTGACATTTCCCCAGG - Intronic
1009272474 6:61631357-61631379 TTTTCTGGTGGTAAGTTTGCTGG + Intergenic
1016047875 6:139498930-139498952 TCCTCTGGTGTCAGGTCTCCTGG - Intergenic
1018042259 6:159935296-159935318 TGCTCTGGTGATAAGACTCCTGG + Intergenic
1018543734 6:164913135-164913157 ATCACTGTTGGCAAGGCTCCTGG - Intergenic
1019750401 7:2725569-2725591 CTCTCTGGAGGAAAGTCTTCAGG - Intronic
1019784796 7:2968505-2968527 TGCTTTCGTGTCAAGTCTCCAGG - Intronic
1020022702 7:4878578-4878600 TGCTCTGGTGTCAGGTCTGCGGG - Intronic
1024564633 7:50671350-50671372 TTCTGTAGTGGCAAATCTCCTGG - Intronic
1025029989 7:55549092-55549114 TTGTCTGTTGGCAAGCCTCTTGG - Intronic
1029308002 7:99635127-99635149 TTCTCTGTTGGCAGCTGTCCTGG + Intergenic
1030509926 7:110471424-110471446 TGCCCTGATGACAAGTCTCCAGG - Intergenic
1033950125 7:146774333-146774355 ATCTCTGGTAGCTATTCTCCCGG + Exonic
1034726770 7:153343468-153343490 TTCTCTGGTAGTGAGACTCCTGG - Intergenic
1037519757 8:19669233-19669255 TTCTGTGGTTGCATGTCTGCTGG - Intronic
1038026908 8:23599019-23599041 TTCTCTGGTGGCAGGTCCTGAGG + Intergenic
1043472580 8:80577985-80578007 TTCTCTGGTGAAAACACTCCAGG + Intergenic
1043560093 8:81483123-81483145 TTCACTGGAGACAAGTTTCCAGG + Exonic
1046592673 8:116224921-116224943 TTTGCTGGTGGCAAGAATCCTGG - Intergenic
1048575456 8:135686481-135686503 TTCTCTGGCTGTTAGTCTCCAGG - Intergenic
1050722449 9:8606110-8606132 CTCTCTGAAGGCATGTCTCCAGG + Intronic
1062378276 9:136274768-136274790 GGCGCTGGTGCCAAGTCTCCCGG - Intergenic
1185835801 X:3345574-3345596 TTGTCTGGGGGCGAGTTTCCTGG - Intronic
1191182900 X:57581506-57581528 TTCTTTGGGGGCAGGGCTCCTGG - Intergenic
1191615217 X:63163003-63163025 TTCTGGGTGGGCAAGTCTCCAGG - Intergenic
1191621081 X:63215920-63215942 TTCTGGGTGGGCAAGTCTCCAGG + Intergenic
1194351769 X:92830027-92830049 TTCACTGGTGGACAGTGTCCAGG + Intergenic
1198481622 X:137046555-137046577 TTCTCTGGTGGAAGGATTCCTGG + Intergenic
1200660082 Y:5946720-5946742 TTCACTGGTGGACAGTGTCCAGG + Intergenic