ID: 1180832729

View in Genome Browser
Species Human (GRCh38)
Location 22:18914155-18914177
Sequence GTTGCTTTTCTAAAAGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180832729 Original CRISPR GTTGCTTTTCTAAAAGCAAC TGG Intronic
901919413 1:12525699-12525721 GTTGGTGTTTTAAAAGCAGCAGG + Intergenic
903218557 1:21856105-21856127 GATTTTATTCTAAAAGCAACAGG - Intronic
905616897 1:39408001-39408023 GTGGCTTTTCTAAAAGCCAAAGG + Intronic
907139069 1:52168521-52168543 TTTTTTTTTTTAAAAGCAACAGG + Intronic
908479896 1:64528687-64528709 GTTGCTTTGCTAAAAGTAGTGGG + Intronic
910100399 1:83569331-83569353 GTTGTTATTCTACAGGCAACAGG - Intergenic
910310454 1:85817985-85818007 CTTGCTTTTCTAAATGGAACTGG - Intronic
910455042 1:87388719-87388741 GATGCATTTCTAAATGTAACAGG - Intergenic
911897209 1:103451852-103451874 GATGCTTGTCTAAAAGGAAGAGG - Intergenic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
915680181 1:157573802-157573824 GATGTTTTTATAAAAGCAAAAGG - Exonic
917012878 1:170494914-170494936 GATGCTTTTATAAATGCAAACGG - Intergenic
918702500 1:187622521-187622543 TGTGCCTTTCTAAAAGCAGCAGG - Intergenic
921939267 1:220823348-220823370 GTTGATTCACTAAAAGAAACTGG - Intergenic
923117963 1:230961734-230961756 GTAACTTATCTAAAGGCAACAGG + Intronic
1064093329 10:12403970-12403992 TTTTTTTTTCCAAAAGCAACAGG - Intronic
1065375326 10:25034333-25034355 ATTGCTTTTCTAAAACCCATAGG - Intronic
1068153502 10:53165741-53165763 GTTGCTTTTCTAGAAATAAAGGG - Intergenic
1070567820 10:77617058-77617080 GTTGCCTTTCTAAAATCCAATGG - Intronic
1071925038 10:90396636-90396658 GTTGTTTTTCAAAAAGAAAGAGG + Intergenic
1073564353 10:104522413-104522435 GTTGCTTCTCAAAAAGCAAAGGG - Intergenic
1075032225 10:119030803-119030825 GCTGCTTTTCAAAAACCACCAGG - Exonic
1076148412 10:128143580-128143602 GATGCTATTCTAAAAGCTACTGG - Intergenic
1077655779 11:4017519-4017541 GTTGATTTCCTATAAGCAGCTGG + Intronic
1078258081 11:9677724-9677746 GCTGTATTTCTAAAAACAACAGG - Intronic
1078945157 11:16057899-16057921 TTTCCTTCTCTAAAAGCATCAGG + Intronic
1079186453 11:18242423-18242445 ATTGCTATTCTCAATGCAACTGG - Intronic
1079961824 11:26933689-26933711 GTTGCTGTTCTCAAAGCCAAAGG + Intergenic
1079984401 11:27185202-27185224 GTTTCTGTTCTCAAAGCCACGGG + Intergenic
1081466123 11:43319434-43319456 TTTGCTTTTTTAATAGAAACAGG + Intronic
1085735881 11:79038667-79038689 GTTGCTTTTCTAGCTGCAATAGG + Intronic
1086215564 11:84375643-84375665 GTTGCCTTTGGAAGAGCAACTGG + Intronic
1087321307 11:96662689-96662711 GTTGCTGTTCTTTGAGCAACAGG + Intergenic
1088845985 11:113668261-113668283 TTTGCCTTCATAAAAGCAACAGG - Intergenic
1090492619 11:127178087-127178109 GTTCCTCTACTAAAAGCCACAGG - Intergenic
1092871342 12:12808493-12808515 CTTGCTTGGCTAAAATCAACAGG + Intronic
1093841577 12:23908960-23908982 TTTTTTTTTCTAAAAACAACAGG - Intronic
1094213598 12:27918288-27918310 TTTGCTTGGCTAAAAGAAACAGG + Intergenic
1095344143 12:41129447-41129469 GTTTCTTTTCTAGAAGAAAAGGG - Intergenic
1096406104 12:51345621-51345643 GGTGGTTTTCTAAATGCAAAAGG - Intronic
1097255519 12:57670970-57670992 GTTGCTTTCCTTGAAGCGACAGG - Intergenic
1097330103 12:58323685-58323707 CTTGCTTTTCTCAGAGCAACAGG - Intergenic
1098967705 12:76809831-76809853 GTTGCTTATCTCATAGCAAAAGG + Exonic
1099340746 12:81430651-81430673 GAAGCTATTCTAAAAGCAAAAGG - Intronic
1099903226 12:88738374-88738396 ATTGATTTTCTACAAGCAAGAGG - Intergenic
1100195899 12:92244037-92244059 GATTCTTTTCTAAGAGCATCAGG - Intergenic
1100205480 12:92344975-92344997 GTTGCTTTTAAATAAGCAGCAGG - Intergenic
1100543724 12:95581587-95581609 GATGCTTTTCTCAAAGAAATAGG + Intergenic
1101733160 12:107443264-107443286 TTAGCTTTTTTAAAAGCAAAGGG + Intronic
1102626935 12:114242660-114242682 GTTGCTTGGCTAAATGCAATAGG - Intergenic
1103297691 12:119902467-119902489 GTTGACATTGTAAAAGCAACTGG + Intergenic
1106228622 13:27803966-27803988 GTTGTTTTTCTTAAAGTAACAGG - Intergenic
1107253436 13:38393240-38393262 GTTGGCATTCTATAAGCAACTGG - Intergenic
1110068503 13:71141746-71141768 GTTGCTTGTCTAAAGGCATGTGG - Intergenic
1111415561 13:87939111-87939133 GTTAATTTTCTTAAAACAACTGG - Intergenic
1112102242 13:96201922-96201944 GTTGCTTGTTTCAAAGGAACTGG + Intronic
1113515350 13:110891721-110891743 GTTGATTTTTTTAAACCAACGGG + Intronic
1114924571 14:27379016-27379038 GCTGCTTTTCTAAAAGTGAGAGG - Intergenic
1115715213 14:36095952-36095974 TTAGCATTTCTAAAAGCAAATGG - Intergenic
1115763431 14:36598435-36598457 GTAGCTTTTCTAAATTCAAATGG + Intergenic
1115927953 14:38457992-38458014 TCTGCTTTTCTAGAAGCTACTGG + Intergenic
1116378820 14:44238327-44238349 GTTGCTTTTTTGAAAGCAAACGG + Intergenic
1119122040 14:72088700-72088722 GATGTTGTTCTAAGAGCAACGGG - Intronic
1119889561 14:78172709-78172731 GTTTATTTTTTAAAAACAACCGG + Intergenic
1120220372 14:81725207-81725229 TTTCATTTTCTAAAATCAACTGG + Intergenic
1121589076 14:95085908-95085930 TTGGCTTTTCTAAAAGCAGGTGG - Intergenic
1124241783 15:28034276-28034298 GTTTCTTTTTTTAAAGCAAGAGG - Intronic
1125675671 15:41501449-41501471 GTGGTTTTTCTGAAAGCGACAGG - Exonic
1128432729 15:67613997-67614019 GTTGATTTTTTAAAAGCAATAGG - Intronic
1130667668 15:85883585-85883607 GGTGCTGTTTTATAAGCAACTGG + Intergenic
1133424600 16:5677017-5677039 GTTGATTTTCTAAAAGAAAAAGG - Intergenic
1135583757 16:23650971-23650993 GATTCTTTTTCAAAAGCAACTGG + Intronic
1137974184 16:53016879-53016901 TTTGCTTTTTTAAAAGAAAAAGG + Intergenic
1138188437 16:54995103-54995125 GCTGATTTTCTAAGAGAAACTGG + Intergenic
1140731754 16:77862899-77862921 TTTGCTTTTGAAAAAGCACCAGG + Intronic
1144181688 17:12758007-12758029 GTTTCTGTTCTAGAAACAACAGG - Intronic
1145229459 17:21162315-21162337 TTTGCTTTTCTTATGGCAACTGG + Intronic
1145788541 17:27609851-27609873 CCTGCTTTTCTAGAAACAACCGG + Intronic
1150127184 17:62645000-62645022 TTTGCTTTTCGAAAAACAACAGG + Intronic
1154198973 18:12286454-12286476 GTTTCTTTTCTTTAAGAAACAGG + Intergenic
1155612390 18:27681357-27681379 GTTACATTTGTAAAAGCAGCAGG - Intergenic
1160047935 18:75405300-75405322 GTGGCTTTTCTCAAATCATCAGG + Intergenic
1160413683 18:78692069-78692091 TTTTTTTTTGTAAAAGCAACAGG - Intergenic
1161362833 19:3860824-3860846 GTTCCGTTTCTTAAAGCAGCAGG - Intronic
1164691411 19:30213445-30213467 GTTGCTTTTCGTAATGTAACAGG + Intergenic
930214489 2:48680714-48680736 GTTGCTTTCCAAAAAGATACAGG - Intronic
935077061 2:99755570-99755592 ATTGGTTTTTTAAAGGCAACTGG + Intronic
937386915 2:121442970-121442992 GTGGCTTTTCTAAACAGAACAGG + Intronic
937870575 2:126783159-126783181 GTTGATTTTTAAAAATCAACAGG + Intergenic
937892727 2:126951573-126951595 GTTGCTCTTATAAAAGAAACTGG + Intergenic
939211751 2:139184229-139184251 CTTGCAATTCTAGAAGCAACTGG + Intergenic
942264752 2:174211598-174211620 TTCGCTTTTTTAAAAGCAAAGGG + Intronic
943493555 2:188587246-188587268 ATTTCTTTTTTAAAAGCAGCAGG - Intronic
945028893 2:205645229-205645251 ACTGCTTTTCTATAAGCAATAGG - Intergenic
945651467 2:212565961-212565983 ATTTCTTTTGTAAAAGGAACTGG - Intergenic
945787296 2:214257813-214257835 GTTGCCTTCATAAAACCAACTGG + Intronic
947153538 2:227137716-227137738 GGTGCCTTTATCAAAGCAACTGG + Intronic
948788189 2:240363954-240363976 GTTTCTTTTCTAAAAGCGGTGGG - Intergenic
1170398078 20:15949514-15949536 GTTGCTTTTCAATACTCAACTGG - Intronic
1173151717 20:40571864-40571886 GTTACTTTTCTAAAAAAAGCAGG + Intergenic
1175110285 20:56643156-56643178 TTTGCTTTTCTGAAATCTACAGG + Intergenic
1175571148 20:60023490-60023512 GCTGCTTTTCAAAAAACAATGGG - Intronic
1176725662 21:10430490-10430512 GTTGCTTTTACAAAAGAAATGGG + Intergenic
1177014890 21:15774462-15774484 TTTGTTTTCCTTAAAGCAACAGG + Intronic
1177820822 21:26029188-26029210 GTTACATTTCTTACAGCAACTGG + Intronic
1178021349 21:28412013-28412035 GGTATTTTTCTAAAAGCAATAGG - Intergenic
1178448583 21:32669285-32669307 GTTGTTTTTCTTAAAGAGACAGG - Intronic
1180832729 22:18914155-18914177 GTTGCTTTTCTAAAAGCAACTGG + Intronic
1184900176 22:47441693-47441715 CTTGCTTTTCAAAAAGGAAAGGG + Intergenic
1203282814 22_KI270734v1_random:139460-139482 GTTGCTTTTCTAAAAGCAACTGG + Intergenic
949205559 3:1434246-1434268 AATGCTTTTCTAAAAGGATCGGG + Intergenic
949847248 3:8384249-8384271 GTTGCTTTCCTAAAATCCTCAGG - Intergenic
950709335 3:14803691-14803713 GATGCTATTCCCAAAGCAACTGG + Intergenic
951584059 3:24197190-24197212 GTTTCTTATCCAAAAGCCACTGG + Intronic
952652479 3:35743199-35743221 ATTGCTTTTCTAATGGAAACAGG - Intronic
952737911 3:36708451-36708473 ATGGCTTTTCTAATAGCAGCTGG + Intergenic
953194219 3:40716974-40716996 GTTGCCCTTCAAAAAGCACCAGG + Intergenic
953571791 3:44076978-44077000 TTTGCTTTTTTGAAATCAACAGG + Intergenic
953677991 3:45018153-45018175 GTTTCTTTTCTCAAAGCTGCTGG - Intronic
955137986 3:56238734-56238756 GTTCCTTCTCTAAAAATAACAGG + Intronic
955746577 3:62146620-62146642 TTTTTTTTTTTAAAAGCAACAGG - Intronic
955809785 3:62775581-62775603 GTTGTTTTTCTTGAAGTAACAGG + Intronic
957192427 3:77026951-77026973 GCTGCTGTTATTAAAGCAACAGG + Intronic
959021642 3:101193866-101193888 GTTACTTTTTGAAAAGCTACAGG + Intergenic
959218639 3:103485149-103485171 GCTGTTTTTCTAAAATCAAGAGG + Intergenic
959416146 3:106078120-106078142 ATAGACTTTCTAAAAGCAACTGG - Intergenic
960184925 3:114626753-114626775 GAAGCTTCTCCAAAAGCAACAGG + Intronic
961083860 3:124049704-124049726 GTCTCTTTTCCAAAAGCAAATGG - Intergenic
961222909 3:125213584-125213606 GTTGTTCTTCTAAAAACAAAAGG + Intergenic
961361653 3:126371776-126371798 GTTGGTATTCTCAGAGCAACGGG + Intergenic
962150765 3:132890941-132890963 GTTGTTTTTCTTGAAGTAACAGG + Intergenic
963460860 3:145613256-145613278 GTTGCTTTTTTAAAAGTTGCAGG + Intergenic
963981014 3:151536954-151536976 CCTGCTGTTTTAAAAGCAACAGG - Intergenic
964403468 3:156323840-156323862 TTGGTTGTTCTAAAAGCAACAGG - Intronic
964683565 3:159369000-159369022 ATTGCTTGTCCAAAAGCACCGGG - Intronic
966206962 3:177414651-177414673 ATTGCATTTCCCAAAGCAACAGG - Intergenic
967472672 3:189880535-189880557 GTTGTTTTTCTAAAATTCACAGG + Intronic
970534767 4:17019564-17019586 GTGGCTTTTCTACCAGCCACTGG + Intergenic
971931807 4:33093690-33093712 GTTGCTTTTATAGCAGCAGCAGG + Intergenic
973162378 4:47033428-47033450 GTTGATTCTAGAAAAGCAACAGG - Intronic
973340804 4:49002113-49002135 GTTGCTTTCAGGAAAGCAACTGG + Intronic
976062421 4:81144518-81144540 TTTGATTTTATAAAAGCAAAGGG + Intronic
976803248 4:89017032-89017054 GTTTGTTGCCTAAAAGCAACAGG + Intronic
980393287 4:132173125-132173147 TTTGCTTTTCTAATAGCATTTGG - Intergenic
980551823 4:134346347-134346369 GTGCCTATTTTAAAAGCAACAGG + Intergenic
981607228 4:146552751-146552773 TAGGCTTTTCTATAAGCAACAGG - Intergenic
982577499 4:157133541-157133563 GTTATTTTTTTAAAAGCAAGGGG + Intronic
983085537 4:163439832-163439854 GCTGCTTTTGTAAAAGCGATTGG - Intergenic
984581376 4:181513922-181513944 TTTGCTTCTCTAAAAGGAAAAGG - Intergenic
986700335 5:10401165-10401187 GTTACTTTTCTAAATTCAGCAGG - Intronic
990760719 5:59126538-59126560 CTTCCTTTTCAAAAAGAAACAGG + Intronic
992401246 5:76413755-76413777 GTTGCTTGTCTAAAAGCCTGAGG + Intronic
994130044 5:96216753-96216775 GTTGCTTTTCTGGAAGTTACAGG + Intergenic
994292788 5:98049868-98049890 GCTTGTTTTCTAAAAGCTACCGG + Intergenic
995071705 5:107930158-107930180 GCTTCTATTCTAAATGCAACAGG - Intronic
996855135 5:127997490-127997512 ATTGCTTCTCTAGAACCAACAGG - Intergenic
996888724 5:128390801-128390823 GTTCCTTTTCTTAAAGTGACAGG - Intronic
998592112 5:143489046-143489068 GTAGTTATTCTAAAAGCAATAGG - Intergenic
1001465769 5:171964561-171964583 GCTGCTTCTTGAAAAGCAACAGG - Intronic
1003152938 6:3568085-3568107 ATGGCTTTTCTAAAAGGAAATGG - Intergenic
1003688281 6:8326510-8326532 TTTGCATTTTTAATAGCAACAGG + Intergenic
1004300147 6:14450218-14450240 GATGCCTTTCAAAGAGCAACTGG - Intergenic
1004552526 6:16662741-16662763 GTTGCTCTTCAAACAGCAAGAGG - Intronic
1005110461 6:22275979-22276001 GTTGATTTTAAAAAAGCAATGGG - Intergenic
1006210604 6:32390532-32390554 GTGGCTTTTCTAACTGGAACTGG + Intergenic
1007164251 6:39817489-39817511 GTTGCTGTTCTAAAGGAAAAGGG + Intronic
1008922222 6:56854243-56854265 TTTGCTTTTCTTAAAACAAAAGG - Intronic
1010415689 6:75609047-75609069 CATACTTTTCTAATAGCAACAGG - Intronic
1010764443 6:79762968-79762990 ATTGCTTTTTTAAAAGAAAATGG + Intergenic
1010832666 6:80550221-80550243 TTGGCTTTGCTAAAAGAAACTGG - Intergenic
1011972540 6:93245741-93245763 TTTGCTTTTCCAAAAGTAATTGG + Intronic
1013215097 6:108020016-108020038 GTTGCTTTTATAAAAGCATGAGG - Intergenic
1013400036 6:109784904-109784926 GTTGGTTTTCTAAAATTTACTGG - Intronic
1013479994 6:110544849-110544871 GTGGATTTTCTAAAACCCACTGG + Intergenic
1014026105 6:116647578-116647600 GTTGATTTTCACAAATCAACTGG - Exonic
1014503197 6:122219765-122219787 AATGCTTTTCTAAAATCAATGGG - Intergenic
1018717914 6:166548551-166548573 ATTGCTTTTCCAAAAGCAGCTGG - Intronic
1020153026 7:5698122-5698144 TTTGCTTTTCAAAAATAAACAGG - Intronic
1020779984 7:12505624-12505646 GTTGCTTTTATAAAACCTATAGG - Intergenic
1020827576 7:13049748-13049770 GTTTCTTTACAAAAAGAAACTGG - Intergenic
1021021606 7:15605710-15605732 GTTATTTTTTAAAAAGCAACAGG - Intergenic
1022328869 7:29359029-29359051 CTTCCTTATCCAAAAGCAACAGG + Intronic
1022493380 7:30837720-30837742 GTAGCGTCTCCAAAAGCAACTGG + Intronic
1022701608 7:32765786-32765808 GTTGCTTTACTAAAAGACAAAGG - Intergenic
1024532494 7:50405489-50405511 GTTGCTATTCTAAGAGCCACGGG - Intergenic
1025951742 7:66150870-66150892 GCTGCCTTTTTAAAAGCAGCAGG - Intronic
1028657337 7:93224077-93224099 GATGATTTTCTAAAATCAATAGG - Intronic
1030884907 7:114924465-114924487 TTTGCATTTCTAAAATCATCTGG + Intronic
1031856058 7:126924046-126924068 GTTTCTTTTCCAACAGCAAATGG + Intronic
1033034906 7:137865460-137865482 GTTGCCTTTCTAAAGGTCACTGG - Intergenic
1034612203 7:152381082-152381104 GTTGCTTTTACAAAAGAAATGGG - Intronic
1035278710 7:157763882-157763904 GTTGCTTCTCTGAAAACAAAAGG - Intronic
1036447471 8:8834579-8834601 GTTTCTATTCTAGGAGCAACAGG + Intronic
1039598519 8:38812677-38812699 GGTTCTATTCTAAGAGCAACAGG - Intronic
1039952928 8:42185807-42185829 TTTCCTTTTCTAAAGTCAACTGG - Intronic
1041683511 8:60619417-60619439 AATGCTTTTCTAACTGCAACTGG - Intronic
1041764605 8:61405225-61405247 CTTGTTTTTCTTAAAGTAACTGG + Intronic
1042280556 8:67051775-67051797 TTTGCTTTTCAAAAAGCAGTAGG - Intronic
1044545069 8:93450031-93450053 GATTCTATTCTAAAAGGAACTGG + Intergenic
1045219139 8:100179968-100179990 GTTGTTTTTCTTAAAGCGACAGG - Intronic
1045402475 8:101832914-101832936 GGTACTTTTCTAAAAATAACTGG - Intronic
1045984902 8:108238702-108238724 GTTGCTTTTCTAAAAATATCTGG + Intronic
1048074982 8:131060441-131060463 ATTGCTTCCATAAAAGCAACAGG - Intergenic
1049851532 8:144834097-144834119 GTTGAGTTCCTAAAAGCCACTGG + Intronic
1050764813 9:9119254-9119276 GTTGTTTTCCTAAAACCAGCTGG + Intronic
1056496516 9:87160540-87160562 GTTGCTTTTCTGAAATCACAAGG + Intergenic
1058907261 9:109492004-109492026 GATGCTTCTCTGAAAGCAGCTGG - Intronic
1185979082 X:4756236-4756258 ATTGCTTTCCTAAAAGCATGAGG + Intergenic
1186016273 X:5198555-5198577 GTTGGTATTCTAAAAGAAAAGGG + Intergenic
1187546059 X:20253330-20253352 GTTGTTTGTCTAAAGGAAACAGG + Intronic
1189883003 X:45511336-45511358 GTTGCCCTCCTAGAAGCAACAGG - Intergenic
1190446181 X:50526646-50526668 TTTGGTTTTCTAAAAGCAATGGG + Intergenic
1192355497 X:70399333-70399355 GCTGTTTTCCTTAAAGCAACAGG - Intronic
1193858885 X:86639933-86639955 GGTGCTTTTGGAACAGCAACAGG + Intronic
1194634693 X:96330525-96330547 GGTGCATTTCTAAAATAAACTGG + Intergenic
1197229552 X:123989489-123989511 TTTGCATTTCTAAAAGCCATGGG - Intronic
1197403643 X:126025255-126025277 GTTTATTTTCTAAAAAGAACAGG - Intergenic
1198704468 X:139433920-139433942 GTTGCTTTGCTAAATGTAGCTGG + Intergenic