ID: 1180834071

View in Genome Browser
Species Human (GRCh38)
Location 22:18921092-18921114
Sequence CACCACAAGGAGAGGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180834071_1180834079 -4 Left 1180834071 22:18921092-18921114 CCAGACCCCCTCTCCTTGTGGTG No data
Right 1180834079 22:18921111-18921133 GGTGTCTTAAGGCTCCGCGTGGG 0: 2
1: 1
2: 0
3: 0
4: 33
1180834071_1180834081 22 Left 1180834071 22:18921092-18921114 CCAGACCCCCTCTCCTTGTGGTG No data
Right 1180834081 22:18921137-18921159 CTGTCCCGCCAAGCACTCTGTGG 0: 2
1: 1
2: 1
3: 6
4: 88
1180834071_1180834078 -5 Left 1180834071 22:18921092-18921114 CCAGACCCCCTCTCCTTGTGGTG No data
Right 1180834078 22:18921110-18921132 TGGTGTCTTAAGGCTCCGCGTGG 0: 2
1: 1
2: 0
3: 2
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180834071 Original CRISPR CACCACAAGGAGAGGGGGTC TGG (reversed) Intronic
No off target data available for this crispr