ID: 1180837233

View in Genome Browser
Species Human (GRCh38)
Location 22:18936014-18936036
Sequence GCTGCTGGCGCGCCACGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 3, 1: 1, 2: 1, 3: 15, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180837233_1180837241 29 Left 1180837233 22:18936014-18936036 CCTGCTCGTGGCGCGCCAGCAGC 0: 3
1: 1
2: 1
3: 15
4: 121
Right 1180837241 22:18936066-18936088 CAGGCTCCGCGCCAGCTCCCAGG 0: 2
1: 1
2: 4
3: 38
4: 333
1180837233_1180837239 10 Left 1180837233 22:18936014-18936036 CCTGCTCGTGGCGCGCCAGCAGC 0: 3
1: 1
2: 1
3: 15
4: 121
Right 1180837239 22:18936047-18936069 CGCACAAGCGCAGCACCAGCAGG 0: 2
1: 2
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180837233 Original CRISPR GCTGCTGGCGCGCCACGAGC AGG (reversed) Exonic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
902080496 1:13817468-13817490 TCTGCTGGTGACCCACGAGCAGG + Intronic
902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG + Exonic
904625145 1:31798236-31798258 GCAGCTGGCCCCCCAGGAGCTGG - Exonic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906674005 1:47680049-47680071 GCTGCTGGCCCTCCATGAGGTGG - Intergenic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
915445491 1:155972272-155972294 GCTGCTGGCCCACCTAGAGCAGG - Intronic
917292166 1:173481668-173481690 GCTGCTGGCAGGCCAAGAGGAGG - Intronic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
921866752 1:220094438-220094460 GCTGCTGGGCCGCCAGCAGCCGG + Exonic
1063393623 10:5666400-5666422 GGTGGTGGCGCGCCCCGCGCTGG - Intronic
1066464430 10:35640418-35640440 CCTGGTGGCGGGCCACGAGAAGG - Exonic
1067110461 10:43396719-43396741 GCTGCTGGAGTGCCGTGAGCAGG - Exonic
1067274060 10:44819053-44819075 GCTGCTGGCGAGGCTCCAGCTGG - Intergenic
1067686066 10:48466581-48466603 GCGGCGGGCGCGCAACAAGCGGG + Intronic
1073403570 10:103277703-103277725 CCTGCTGGAGCGCGACGGGCTGG + Exonic
1073403578 10:103277742-103277764 GCTGCGGGCGCGCTGCGAGGAGG + Exonic
1075885468 10:125896150-125896172 GGGGCGGGCGCGCCCCGAGCCGG - Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1085266687 11:75241622-75241644 GCTCCAGGCGCGCCAGGCGCAGG - Exonic
1085295600 11:75430005-75430027 GCTGCTGGCGGACCCCGCGCTGG - Exonic
1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG + Intronic
1089556491 11:119318250-119318272 TCTGCTGGCGCGCCTCCACCAGG + Intronic
1090422217 11:126583261-126583283 GCTGCTGGCAGGCCTAGAGCGGG - Intronic
1090976153 11:131682473-131682495 GCTGCATGCGTGCCACGAGGAGG - Intronic
1100980543 12:100159020-100159042 GCTGCAGCCGGTCCACGAGCTGG + Intergenic
1103392483 12:120584623-120584645 GCGGCTGGCGCAGCCCGAGCCGG - Intergenic
1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG + Exonic
1107910489 13:45101017-45101039 GCTGCTGGCATGCGAGGAGCTGG + Intergenic
1108478374 13:50843214-50843236 GCTGCTGGGGCCCCTCCAGCAGG - Exonic
1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG + Intronic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1117092851 14:52267931-52267953 GCTGCTGGCGCGCTCGGGGCTGG + Exonic
1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG + Exonic
1119472710 14:74909594-74909616 GCTGGAGGCGCTGCACGAGCAGG - Exonic
1202872590 14_GL000225v1_random:177767-177789 GGGGCGGGCGCGCCCCGAGCCGG + Intergenic
1124328823 15:28789549-28789571 GCTGCTGCGGCGCCATGATCTGG - Intergenic
1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG + Intergenic
1126725092 15:51623178-51623200 GCCGGGGACGCGCCACGAGCCGG + Intergenic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG + Intergenic
1139785011 16:69385746-69385768 CCGGCGGGGGCGCCACGAGCCGG - Exonic
1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG + Exonic
1143021093 17:3917551-3917573 CTTGCTGGCGAGCCATGAGCTGG + Intergenic
1146890837 17:36505548-36505570 GCTGCAGGCTCTCAACGAGCAGG + Intronic
1147334140 17:39716610-39716632 GCTGCTGGCGGGCTCAGAGCTGG + Intronic
1152037428 17:77881770-77881792 GCTGATGTCTCGCCTCGAGCTGG - Intergenic
1152586236 17:81190661-81190683 GCTGCAGGCCCGCCAGCAGCTGG - Exonic
1152644768 17:81463673-81463695 ACTGCTCGCGCGCCACGACCTGG - Exonic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1160583198 18:79899312-79899334 GCGCCTGGCGCGCCACTCGCTGG + Exonic
1160763381 19:796815-796837 ACTGCGGGCGCGCCATGATCCGG - Intergenic
1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG + Exonic
1161215753 19:3094453-3094475 GCGGCTGGCGCGGCCCGAGCGGG + Exonic
1162486086 19:10961260-10961282 GCTGCCGGCGCGCCCTGTGCGGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163720420 19:18895868-18895890 GCTGCTGGCGCTCGGCGCGCTGG - Exonic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1166091661 19:40513213-40513235 GGTGCTGGCGCGCCAGGCGGCGG - Exonic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166571301 19:43798706-43798728 GATCCTAGCGCGCCAAGAGCAGG + Intronic
1167258223 19:48443402-48443424 GGGGCTGGCGCGCCGGGAGCTGG + Exonic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
926092310 2:10058867-10058889 GCTGATGGCGAGCATCGAGCGGG - Exonic
926575430 2:14575488-14575510 GCTGCTGGCTCCCCAGGGGCAGG - Intergenic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927887580 2:26728169-26728191 GCTGCTCACGCGCAACGGGCAGG + Exonic
927980447 2:27371322-27371344 GCTCCTGGGGCTGCACGAGCAGG + Exonic
929511431 2:42568625-42568647 GCTGCTGCCTCGCCACGGGGGGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930700566 2:54455905-54455927 GCTGCTGCCGCTACCCGAGCAGG - Intergenic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
935971524 2:108534453-108534475 GCTACTGGCGGGCCCGGAGCAGG - Intronic
937160950 2:119760233-119760255 GCAGCGGTCGCGCCACGACCCGG - Exonic
942653982 2:178195256-178195278 GCTGCAGGGGCGCCAGCAGCGGG - Intronic
944104769 2:196068448-196068470 CCTGCTGGCGCGCCGCTAGGCGG + Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
947593184 2:231396279-231396301 GCTGCGGGCGCTCCACCTGCCGG - Intronic
947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG + Exonic
948862635 2:240760307-240760329 GCTGGCGGAGCGCCAAGAGCGGG - Intronic
949015740 2:241709283-241709305 TCTGCAGGCGCTCCACGCGCTGG - Exonic
1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG + Intergenic
1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG + Intergenic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181060009 22:20277931-20277953 ACTGCTGGTGCGCCCTGAGCGGG - Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1181793048 22:25282798-25282820 GCTGGTGGGGCGCGCCGAGCAGG + Intergenic
1181813688 22:25421086-25421108 GCTGCTGGGGCGCGCAGAGCGGG + Intergenic
1183431003 22:37765729-37765751 GCTGCAGCGGCACCACGAGCGGG + Exonic
1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG + Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
966721240 3:183064527-183064549 GCTGGTGGCGTGCCATGAGCAGG - Intronic
967740445 3:192997601-192997623 GCTGCTGCCGAGCCATGAACTGG - Intergenic
969676940 4:8619509-8619531 GCTGCCTGCGCGCCCGGAGCGGG - Exonic
979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG + Exonic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
1001984216 5:176060597-176060619 GCTGCGGGCGCGCCACGTCTAGG - Intronic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002233259 5:177783468-177783490 GCTGCGGGCGCGCCACGTCTAGG + Intronic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002262719 5:178006313-178006335 GCTGCGGGCGCGCCACGTCTAGG - Intergenic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG + Intronic
1018400389 6:163414850-163414872 GCTGCTGGCGCCGGACGAGGAGG - Exonic
1018613462 6:165663532-165663554 GCTGCTGGCCCGCTACCAGGAGG - Intronic
1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG + Exonic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1026936147 7:74257003-74257025 TCTGCTGGCGTGCCAAGATCAGG + Intergenic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1028477149 7:91265024-91265046 GCAGCTGGCGCGCCAATCGCCGG - Exonic
1028909523 7:96192440-96192462 GATTCTGGTGCTCCACGAGCAGG + Intronic
1029413622 7:100430169-100430191 GCAGATGGCGCGCAACGACCCGG - Exonic
1035901801 8:3465133-3465155 GCTGCTGGGGCCTCACCAGCAGG + Intronic
1040951233 8:52940497-52940519 GCGGCTCGCGCGCCACCAGAAGG - Exonic
1048306281 8:133286975-133286997 GCTGCTGGCGGTCCACCATCTGG + Intronic
1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG + Exonic
1049419623 8:142510964-142510986 GCGGCAGCCGCGCCACGACCAGG - Exonic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG + Exonic
1057261334 9:93586483-93586505 GCTGCTGGCCCTCCCCCAGCTGG - Intronic
1058826114 9:108777423-108777445 GCTGCAGGCTCGCCACCTGCAGG - Intergenic
1058885882 9:109320823-109320845 GCTGCTCCCGCGCCGCGCGCCGG + Exonic
1058971767 9:110089816-110089838 GCTGCTGGCTCTCCACGATAAGG - Intronic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061609881 9:131739549-131739571 GCTGCGGGGGCGCCAGGGGCCGG - Intronic
1203731865 Un_GL000216v2:98775-98797 GGGGCGGGCGCGCCTCGAGCCGG - Intergenic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic
1200161880 X:154013789-154013811 GCTGCTGCCGCGCCCCCTGCTGG - Intronic