ID: 1180840558

View in Genome Browser
Species Human (GRCh38)
Location 22:18957037-18957059
Sequence CCTGATGCGCAGGCAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180840547_1180840558 17 Left 1180840547 22:18956997-18957019 CCTGCTGGAGGCAAGGTGGGCGT 0: 2
1: 0
2: 2
3: 15
4: 146
Right 1180840558 22:18957037-18957059 CCTGATGCGCAGGCAGTGGCTGG 0: 1
1: 1
2: 1
3: 25
4: 193
1180840546_1180840558 18 Left 1180840546 22:18956996-18957018 CCCTGCTGGAGGCAAGGTGGGCG 0: 2
1: 0
2: 2
3: 10
4: 166
Right 1180840558 22:18957037-18957059 CCTGATGCGCAGGCAGTGGCTGG 0: 1
1: 1
2: 1
3: 25
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180840558 Original CRISPR CCTGATGCGCAGGCAGTGGC TGG Intergenic
900553646 1:3269184-3269206 CCCAAGGAGCAGGCAGTGGCTGG + Intronic
900579585 1:3402505-3402527 CCTGAGGCACAGGCAGGGCCGGG + Intronic
901048896 1:6416331-6416353 CCTCCTCCACAGGCAGTGGCAGG - Exonic
901514581 1:9736389-9736411 CCAGCTGAGAAGGCAGTGGCTGG - Intronic
902466239 1:16620375-16620397 CCAGAGCCCCAGGCAGTGGCTGG + Intergenic
903364026 1:22794866-22794888 CCAGATGAAAAGGCAGTGGCTGG - Intronic
904176003 1:28629446-28629468 CCAGATGCTCAGGCTGAGGCAGG - Intronic
905790562 1:40787045-40787067 CCAGAGACGCAGGCTGTGGCAGG + Intronic
905947921 1:41919316-41919338 CCTGATCTGCAGCCAGAGGCTGG - Intronic
905960913 1:42041361-42041383 CCTCATGCAGAGGCAGTGGCCGG - Intergenic
907284606 1:53371623-53371645 CCTGGTGCCCAGGCTGTGGGGGG - Intergenic
910614896 1:89186688-89186710 TGTGATGCGAAGGCACTGGCTGG + Intronic
914858365 1:151368245-151368267 CCCGCTGGCCAGGCAGTGGCTGG + Exonic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
916354429 1:163888887-163888909 TCTGATCCACAGGCAGTGGAGGG - Intergenic
918554983 1:185787997-185788019 ACTGATACCCAGGCAGTAGCAGG + Intronic
920003342 1:202814189-202814211 CCTGCTGCGGAGGCTGAGGCAGG + Intergenic
1064156349 10:12906337-12906359 GCTCATGCCCAGGCTGTGGCGGG + Intronic
1065431720 10:25664955-25664977 CCTGAAGAGCAGCCAGTTGCTGG - Intergenic
1069761480 10:70814651-70814673 CTTGATGAGTAGGCATTGGCAGG + Intergenic
1070167219 10:73907929-73907951 CCAGATGCGCAGGGAGGGGCAGG - Intergenic
1070780996 10:79137512-79137534 CCTGGTGGACAGGCAGGGGCGGG + Intronic
1070803188 10:79255317-79255339 CCTGAGGGGCAGGCAGTGCCTGG + Intronic
1070811800 10:79301809-79301831 CATGATGGGGAGGCAGTGGTAGG + Intronic
1073403167 10:103275538-103275560 CCAGAGGGGCAGGCTGTGGCAGG + Intergenic
1073469988 10:103716325-103716347 CCTGATGGGCAGGCTGAGGCAGG + Intronic
1074533980 10:114315607-114315629 CCTGTGGCGCAAGAAGTGGCTGG - Exonic
1075408995 10:122213601-122213623 CCTGATAAGCAGGCAGATGCTGG - Intronic
1075804464 10:125175566-125175588 CCTCATGAGTAGGCAGAGGCTGG - Intergenic
1076206603 10:128609291-128609313 CCTGGTGAGCAGGAAGTGCCTGG - Intergenic
1076337175 10:129714826-129714848 CCTGGTCCACTGGCAGTGGCTGG + Intronic
1076473339 10:130735442-130735464 CCAGATGGGCAGGCAGAGGTGGG + Intergenic
1076823808 10:132957259-132957281 CAGGCTGCGCTGGCAGTGGCCGG + Intergenic
1076831358 10:132996046-132996068 CCCGAGGCCCAGGCAGTGTCTGG + Intergenic
1077625989 11:3771816-3771838 CCTGTTGCGCTGGAAGTGGCTGG + Exonic
1079107039 11:17578369-17578391 CCTGCTGGGCAGGCAGCAGCTGG - Exonic
1080702178 11:34653249-34653271 CCTGAGGCTCAGGAAGTGGTTGG - Intronic
1082762241 11:57138616-57138638 CAGGATGCTCAGGCAGTGGGTGG + Intergenic
1083613140 11:64013929-64013951 CCTGATGCCCAAGCAGGGACAGG + Intronic
1084522204 11:69670462-69670484 CCTGGTTCTCAGGCAGCGGCCGG - Intronic
1091122141 11:133065360-133065382 CCTGGAGCACAGGCAGTGGCGGG - Intronic
1092358672 12:7817886-7817908 CCAGCTGCGATGGCAGTGGCCGG - Exonic
1092371811 12:7922876-7922898 CCAGCTGCGATGGCAGTGGCCGG - Exonic
1094499347 12:31008548-31008570 CCTGATGTGCAGGCTGGGGCTGG - Intergenic
1100490516 12:95073593-95073615 GCTAATGCGCAGGCGCTGGCGGG - Exonic
1103685568 12:122729712-122729734 CCTGAGGCGGAGGCAGCAGCTGG - Exonic
1104241426 12:126993854-126993876 ACTGGTTCGCAGCCAGTGGCAGG + Intergenic
1104660425 12:130608117-130608139 CCTGGTTCCCAGGCAGGGGCTGG - Intronic
1104988045 12:132608355-132608377 CGTGGTGCTCACGCAGTGGCAGG - Intronic
1107458579 13:40578499-40578521 GCTGATACACAGTCAGTGGCTGG - Intronic
1109705946 13:66092801-66092823 CCTGCTGCGTCGGCACTGGCAGG - Intergenic
1113646304 13:111998926-111998948 CCTGAGGCCAAGGCAGTGCCCGG + Intergenic
1113767096 13:112888455-112888477 CCTGATGGGCAGGGAGGGCCAGG - Intergenic
1113794383 13:113048802-113048824 CGTGATGCCCAGGCAGTGCCTGG - Intronic
1121273386 14:92652168-92652190 TCTTCTTCGCAGGCAGTGGCGGG - Exonic
1122179396 14:99944389-99944411 CTCCATGCGCAGGCAGTGCCAGG + Intergenic
1122306428 14:100769532-100769554 GCTGATGCCCAGGAAGTGGCGGG - Intergenic
1122462746 14:101908968-101908990 CCTGCTGCGCAGGCTTTCGCTGG + Intronic
1122518765 14:102327626-102327648 GATGATGAGCAGGCAGGGGCAGG - Intronic
1122941397 14:104983003-104983025 CCTGATGAGCAAGGACTGGCTGG - Intergenic
1123019942 14:105392954-105392976 CCACATGCGCAGGCAGGGGCGGG + Intronic
1123757515 15:23408381-23408403 GCTAATGCTCAGGCAGAGGCTGG + Intergenic
1123976399 15:25558347-25558369 CCTGATGGAAAGGCAGTGGTGGG + Intergenic
1124350165 15:28949404-28949426 CGTGATGCGTAGGAACTGGCTGG - Intronic
1124494475 15:30178000-30178022 CCGGAGGGGCAGGCAGGGGCTGG + Intergenic
1124749095 15:32360645-32360667 CCGGAGGGGCAGGCAGGGGCTGG - Intergenic
1126100736 15:45116916-45116938 CCTGAGGTCCAGGCGGTGGCTGG - Intronic
1128726233 15:69990607-69990629 CCTCATGCACAGGCAGTAGAAGG - Intergenic
1128780999 15:70358616-70358638 GGTGACCCGCAGGCAGTGGCAGG - Intergenic
1132143737 15:99414776-99414798 CCTGAAGCGCAGGAGGTGGTAGG + Intergenic
1132942025 16:2513248-2513270 CCTGATGCAAAGGCAGAGACAGG + Intronic
1132944268 16:2523913-2523935 AGAGATGCGCAGGCAGTGGGGGG - Intronic
1133128447 16:3662052-3662074 CTGCATGCGCAGGAAGTGGCGGG + Exonic
1133317015 16:4891179-4891201 CCTCATGACCAGACAGTGGCAGG - Intronic
1134458819 16:14414380-14414402 GCTAATGCTCAGGCAGAGGCTGG - Intergenic
1136008156 16:27345163-27345185 ACTGAGGCCCAGGCAGGGGCAGG - Intronic
1138006311 16:53341136-53341158 TCTGTCGCCCAGGCAGTGGCAGG - Intergenic
1138525900 16:57607088-57607110 CCTCCTGCTCAGGCAGGGGCAGG + Intergenic
1138993307 16:62417906-62417928 CCACAGGTGCAGGCAGTGGCTGG + Intergenic
1139910696 16:70395614-70395636 CCTGGGGCTCAGGGAGTGGCTGG - Intronic
1140137832 16:72223511-72223533 CCTTATGACCAGTCAGTGGCTGG + Intergenic
1140842264 16:78850697-78850719 CCTGGTTCACAGGCAGTGACTGG - Intronic
1141628194 16:85272549-85272571 CCTCAGGCCCAGGCAGTGGGAGG + Intergenic
1141685356 16:85566904-85566926 CCTACTGCCCATGCAGTGGCCGG - Intergenic
1142127889 16:88419284-88419306 CCTGGTGGGCAGCCAGAGGCCGG + Intergenic
1143904309 17:10197608-10197630 CCAGGGGAGCAGGCAGTGGCGGG + Intronic
1144407542 17:14966657-14966679 CCTGAGTCCCAGGCACTGGCAGG + Intergenic
1144769114 17:17749376-17749398 CCTGATGCCTAGGCAGTGCGTGG - Intronic
1144812763 17:18011297-18011319 CCTGCTGCGCTGGCTGGGGCAGG - Intronic
1145911802 17:28547457-28547479 CCTGAAGCCCCTGCAGTGGCGGG - Intronic
1149689263 17:58560423-58560445 ACTGCTGCTCAGGCAGTGGCTGG - Intronic
1152277223 17:79364900-79364922 CCTGGTGCCCAGGGAGTGGCTGG + Intronic
1152521709 17:80860293-80860315 CCTGTTGTCCAGGCACTGGCAGG + Intronic
1152540216 17:80970946-80970968 CCTGATGGGCAGGCGGGGGCGGG + Intergenic
1152719273 17:81914923-81914945 CCTGATGCACCTGGAGTGGCTGG + Intronic
1160830413 19:1102095-1102117 CCTGAGTCGGGGGCAGTGGCGGG + Intergenic
1160860794 19:1236614-1236636 CCTGGCGCGCAGGCAGCGGGAGG - Intronic
1162153966 19:8664361-8664383 GCTGATGGGCAGGAAGTGGGGGG - Intergenic
1162378131 19:10316862-10316884 CCAGATGGGCAGGCAGGGGCAGG + Exonic
1163366212 19:16877423-16877445 CCTCATGCTCTGGCAGTGGGGGG + Intronic
1167096633 19:47378005-47378027 ACTGAAGCTCAGGCAGGGGCGGG + Intronic
925931201 2:8709491-8709513 CCTGCTGTGCAGGCAGGAGCAGG + Intergenic
927675591 2:25103681-25103703 GTTGATGCTCTGGCAGTGGCAGG - Exonic
927916826 2:26942521-26942543 CCTGGTGGGGAGGCAATGGCGGG - Exonic
930662123 2:54064714-54064736 AATGATGCGGAGGCAGTGACAGG + Intronic
933989230 2:87621760-87621782 CCTGATGAGCATCCAGTGGAAGG - Intergenic
935888852 2:107653699-107653721 CGTGATGCTCAGGCTCTGGCTGG - Intergenic
936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG + Intergenic
937997013 2:127701738-127701760 CGTGACGCGCGGGCAGCGGCTGG + Exonic
938435526 2:131281182-131281204 CCTGCTGCAGAGGCAGAGGCTGG + Intronic
942847648 2:180445509-180445531 CCAGATGAGCAAGCGGTGGCTGG - Intergenic
946176037 2:217922490-217922512 CCTGGGGCCCTGGCAGTGGCAGG - Intronic
946355591 2:219182422-219182444 CCTCAGGGGCAGGCAGGGGCTGG - Exonic
948027369 2:234788984-234789006 CCTGATGCTGAGGCTGCGGCCGG + Intergenic
1171071549 20:22073502-22073524 CCAGATGCACAGACAGTGGTAGG - Intergenic
1172272122 20:33660542-33660564 CCTGATGGGCAGGGAGGGTCTGG + Intronic
1172854966 20:37994679-37994701 CCTGATGGGCAGGGAGGGGGAGG - Intronic
1172924372 20:38517870-38517892 TCCGAGGGGCAGGCAGTGGCCGG - Exonic
1173503844 20:43571922-43571944 TCTGATGCCCAGGCACAGGCTGG - Intronic
1173924541 20:46771089-46771111 CCTGATGCCCAGGAATGGGCAGG + Intergenic
1174616228 20:51837674-51837696 GCTGTTGCCCAGACAGTGGCAGG - Intergenic
1174729242 20:52898643-52898665 CCTGATGTGATGGCAGTGACGGG - Intergenic
1175384597 20:58586257-58586279 CATGATGAGCAGGAAGTGTCTGG + Intergenic
1176169702 20:63691247-63691269 CCTCAAGCGCAGCCAGTGGCAGG - Intronic
1176292767 21:5055076-5055098 CCTGGAGGGCAGGCAGAGGCAGG - Intergenic
1179465379 21:41568230-41568252 CCTGCTGCCCAGACAGTGCCTGG - Intergenic
1179799332 21:43803586-43803608 CCCGAGGCGCGGGCAGAGGCTGG + Exonic
1179864493 21:44208574-44208596 CCTGGAGGGCAGGCAGAGGCAGG + Intergenic
1180840558 22:18957037-18957059 CCTGATGCGCAGGCAGTGGCTGG + Intergenic
1180974716 22:19842024-19842046 CCTGATGAGCAGGAGGTGGGAGG - Intronic
1181057396 22:20266653-20266675 CCTGGTGGGTAGGGAGTGGCTGG + Intronic
1181060935 22:20281737-20281759 CCCGATGCGCAGGCAGTGGCTGG - Intronic
1181515075 22:23405545-23405567 CCTGATGTGCAGGCGGTGGCTGG - Intergenic
1181743247 22:24938148-24938170 CCAGGGGTGCAGGCAGTGGCAGG - Exonic
1181809730 22:25396066-25396088 CCTGATGAGCTGGCAGTCTCAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183832977 22:40428827-40428849 CCTGATGAGAAGGCACTGGAAGG - Intronic
1184066403 22:42124167-42124189 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184068871 22:42136319-42136341 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184597359 22:45522374-45522396 CTTGATGCTCAGGAAGAGGCAGG + Intronic
1184756584 22:46519552-46519574 CCTGATGCCCAGGCTCTGCCTGG - Intronic
950368061 3:12503292-12503314 GCTGATGCGTAGACAGGGGCAGG + Exonic
950794950 3:15503204-15503226 TCTGATGGGAAGTCAGTGGCTGG - Intronic
955596118 3:60592581-60592603 CCTGCTGCCCAGGCAGTGAATGG - Intronic
960005520 3:112777273-112777295 TCTGGTGTGCAGGCAGTGGGGGG + Intronic
960943173 3:122947678-122947700 CCTGTTGGGGAGGCAGTGCCAGG - Intronic
961502831 3:127349990-127350012 GCTGCTGCGCAGGCGGGGGCAGG + Intergenic
962268385 3:133959780-133959802 TCTGTCGCCCAGGCAGTGGCAGG - Intronic
967056029 3:185829173-185829195 CCTGATGCACAGGCAGGTGCAGG - Intergenic
967386481 3:188916593-188916615 CCTGGGGAGCAGGCAGTGGGGGG + Intergenic
968755188 4:2412046-2412068 CCTGGGGCGCAGGCAGGGGCAGG + Intronic
968879552 4:3292260-3292282 CCAGAGGCGCAGGCCGGGGCCGG + Intergenic
968962258 4:3751614-3751636 CCTGATGCTCAGGGACTGTCTGG + Intergenic
974876946 4:67713072-67713094 CTTGCTGGGCAGGCAGTGGCAGG - Intergenic
983987574 4:174078820-174078842 TCTGATGGGCAGGCATTGGGTGG - Intergenic
985510516 5:310712-310734 ACTGAAGGGCACGCAGTGGCAGG - Intronic
985639252 5:1055956-1055978 CCTTGTGGGCAGGCAGTGCCTGG - Intronic
989556606 5:42803860-42803882 GCAGATGGGCAGGCAGTGGAAGG + Intronic
992072208 5:73158505-73158527 CATGAAGGGCAGGCACTGGCAGG - Intergenic
993901581 5:93587695-93587717 CCAGGGGCTCAGGCAGTGGCTGG + Intronic
996494081 5:124133082-124133104 CCTGATTAGCCTGCAGTGGCAGG + Intergenic
1001919300 5:175587858-175587880 TCTGACTTGCAGGCAGTGGCAGG + Intergenic
1001995478 5:176153989-176154011 GCTGAGGCTCAGGCAGTGGCAGG - Intergenic
1002136382 5:177110345-177110367 GCAGATGGGCAGGCAGTGGAGGG + Intergenic
1002147875 5:177200132-177200154 TCTGTTGCCCAGGCTGTGGCAGG + Intronic
1003398247 6:5771302-5771324 CGTGATGCGGTAGCAGTGGCTGG - Exonic
1003897175 6:10618143-10618165 TCTGAGGCGCAGAAAGTGGCAGG - Intronic
1004504684 6:16238499-16238521 CCTGAGGCGGAGGCGGTGCCCGG + Intergenic
1006020327 6:31114133-31114155 CCTGATCTGCAGCCAATGGCAGG - Intergenic
1007470663 6:42088273-42088295 CCTGATGGGTGGGCAGGGGCTGG + Intergenic
1007553463 6:42746981-42747003 CCAGCTGCGGAGGGAGTGGCCGG - Intronic
1007733489 6:43966039-43966061 CCTGACCCCCAGGCAGTGGCTGG - Intergenic
1008973895 6:57401939-57401961 TCTGCTGCAGAGGCAGTGGCAGG + Intronic
1009162785 6:60303444-60303466 TCTGCTGCAGAGGCAGTGGCAGG + Intergenic
1013429683 6:110044264-110044286 CCTGGTGCCCGGGCAGGGGCGGG + Intergenic
1018490483 6:164287735-164287757 CCTGTTGAGCAGGCAGGCGCTGG + Intergenic
1019354218 7:570517-570539 ACTGCTGGGCAGGCAGTGGGGGG - Intronic
1026261816 7:68762003-68762025 CATGCAGCTCAGGCAGTGGCAGG - Intergenic
1027050741 7:75019785-75019807 CCTGAGATGCAGGCAGGGGCCGG + Intronic
1028478699 7:91280369-91280391 CTTGATGTGCAGGCAGAGGAGGG + Intergenic
1029460710 7:100692740-100692762 CCTGGTCCCCAGGCAATGGCAGG + Intergenic
1029543100 7:101196135-101196157 CCTGATGCCCACGCAGCTGCTGG + Intronic
1030361424 7:108599172-108599194 CCTGATTTGAAGGCATTGGCAGG - Intergenic
1032496087 7:132363930-132363952 CCTGCTGCCCAGGCTGTGGCTGG + Intronic
1032802462 7:135327883-135327905 TCTGATGGCCAGGCAGTAGCAGG - Intergenic
1033903309 7:146170054-146170076 TCTGTTGCGCAGGCTGAGGCTGG + Intronic
1035139146 7:156739196-156739218 CCCCATGGGCTGGCAGTGGCAGG + Intronic
1035293183 7:157853076-157853098 CCAGATCAGCAGGCAGTGGATGG + Intronic
1035338234 7:158143731-158143753 CACGATTCGCAGGAAGTGGCAGG + Intronic
1037293956 8:17381340-17381362 CCTGACGCCCAGGCAGTGAAGGG - Intronic
1037814031 8:22102587-22102609 CCTGGTGCGCAAGCAGTTGACGG + Exonic
1038711368 8:29949994-29950016 CCTGCTGCACAGGCAGAGGATGG + Intergenic
1040549582 8:48427906-48427928 CCTGTTGGGTGGGCAGTGGCAGG + Intergenic
1040725429 8:50377003-50377025 CATGATGCCCAGGCAGGAGCCGG - Intronic
1046854444 8:119015305-119015327 CCTAATGGGCAGACAGTGGGAGG - Intronic
1047078065 8:121426995-121427017 CCTGATGCTCTAGCAGAGGCTGG - Intergenic
1048308115 8:133297444-133297466 CCTGTTGCGCAAGCAGTCGTAGG + Exonic
1048345719 8:133572699-133572721 CCAGATGCGGAGGCTGCGGCTGG + Intergenic
1048737647 8:137519467-137519489 TCTGATGTGCAGGCACTGGTGGG + Intergenic
1048972054 8:139650636-139650658 ACTCATGTGCAGGCAGTGGCTGG + Intronic
1049719075 8:144107299-144107321 CCTGCTGCCCATGCTGTGGCCGG + Exonic
1049905697 9:214743-214765 CCTGGCGCGCAGGCAGCGGCGGG - Exonic
1050265656 9:3886955-3886977 CCTGATGCAGAGGCAGGGGAAGG - Intronic
1051721534 9:20042105-20042127 CCTGGTGGGCAGACTGTGGCAGG + Intergenic
1056307000 9:85300235-85300257 CCAGATGCACAGGCAGGTGCAGG + Intergenic
1057514734 9:95711629-95711651 CATGAGTGGCAGGCAGTGGCTGG - Intergenic
1058120732 9:101135837-101135859 CCTGCTGGGCAGACAGAGGCAGG - Intronic
1058584703 9:106494571-106494593 TCTGTTGCCCAGGCAGTGGCGGG + Intergenic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1059887386 9:118761548-118761570 AATGAAGCGCAGCCAGTGGCTGG - Intergenic
1061542229 9:131283498-131283520 CCAGGTGCTCAGGCAGTGCCTGG - Intergenic
1061769675 9:132908932-132908954 CCTGTTGCCCAGGCTGGGGCTGG + Intronic
1062101606 9:134731431-134731453 CCTGATGGAGAGGCAGTGCCTGG + Intronic
1185891693 X:3827835-3827857 GATGATGGGCAGGCAGAGGCAGG + Intronic
1185896802 X:3866249-3866271 GATGATGGGCAGGCAGAGGCAGG + Intergenic
1185901920 X:3904676-3904698 GATGATGGGCAGGCAGAGGCAGG + Intergenic
1190297699 X:49038280-49038302 CCTCAGGGGCAGGCAGTGGCTGG + Exonic
1190503593 X:51103188-51103210 CCTGATTCTCAGTCAGAGGCTGG + Intergenic
1192409944 X:70925183-70925205 TCTGATGCTCAGGCAGTTACAGG + Intergenic
1196673574 X:118395264-118395286 CCTGATGGGCAGACTGTAGCAGG + Exonic
1200066949 X:153508505-153508527 CCTGATGGGGAGGCAGAGCCAGG + Exonic