ID: 1180841481

View in Genome Browser
Species Human (GRCh38)
Location 22:18960863-18960885
Sequence GCTGCTGGCGCGCCCTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180841480_1180841481 -9 Left 1180841480 22:18960849-18960871 CCTGAGAGAGGGGTGCTGCTGGC No data
Right 1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG No data
1180841478_1180841481 -8 Left 1180841478 22:18960848-18960870 CCCTGAGAGAGGGGTGCTGCTGG No data
Right 1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG No data
1180841471_1180841481 9 Left 1180841471 22:18960831-18960853 CCCAGGCCTGGCCATGTCCCTGA 0: 2
1: 0
2: 3
3: 53
4: 472
Right 1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG No data
1180841477_1180841481 -2 Left 1180841477 22:18960842-18960864 CCATGTCCCTGAGAGAGGGGTGC No data
Right 1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG No data
1180841472_1180841481 8 Left 1180841472 22:18960832-18960854 CCAGGCCTGGCCATGTCCCTGAG 0: 2
1: 0
2: 4
3: 49
4: 490
Right 1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG No data
1180841473_1180841481 3 Left 1180841473 22:18960837-18960859 CCTGGCCATGTCCCTGAGAGAGG 0: 2
1: 0
2: 1
3: 27
4: 247
Right 1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180841481 Original CRISPR GCTGCTGGCGCGCCCTGAGC AGG Intergenic
No off target data available for this crispr