ID: 1180842752

View in Genome Browser
Species Human (GRCh38)
Location 22:18966933-18966955
Sequence GCCCCCCAGCTCCCTGGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180842747_1180842752 9 Left 1180842747 22:18966901-18966923 CCCTCTGTGGTGAGAGCAGATGG No data
Right 1180842752 22:18966933-18966955 GCCCCCCAGCTCCCTGGCACCGG No data
1180842744_1180842752 26 Left 1180842744 22:18966884-18966906 CCTTGGGCATGCAGCCACCCTCT No data
Right 1180842752 22:18966933-18966955 GCCCCCCAGCTCCCTGGCACCGG No data
1180842746_1180842752 12 Left 1180842746 22:18966898-18966920 CCACCCTCTGTGGTGAGAGCAGA No data
Right 1180842752 22:18966933-18966955 GCCCCCCAGCTCCCTGGCACCGG No data
1180842749_1180842752 8 Left 1180842749 22:18966902-18966924 CCTCTGTGGTGAGAGCAGATGGC No data
Right 1180842752 22:18966933-18966955 GCCCCCCAGCTCCCTGGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180842752 Original CRISPR GCCCCCCAGCTCCCTGGCAC CGG Intergenic
No off target data available for this crispr