ID: 1180843741

View in Genome Browser
Species Human (GRCh38)
Location 22:18970754-18970776
Sequence CGGCTACGCTTCCCCAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180843741_1180843756 18 Left 1180843741 22:18970754-18970776 CCAAGGCTGGGGAAGCGTAGCCG No data
Right 1180843756 22:18970795-18970817 CGCAGTGCCGCGCCAGGCTGGGG No data
1180843741_1180843759 25 Left 1180843741 22:18970754-18970776 CCAAGGCTGGGGAAGCGTAGCCG No data
Right 1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG No data
1180843741_1180843757 24 Left 1180843741 22:18970754-18970776 CCAAGGCTGGGGAAGCGTAGCCG No data
Right 1180843757 22:18970801-18970823 GCCGCGCCAGGCTGGGGCCAAGG No data
1180843741_1180843753 16 Left 1180843741 22:18970754-18970776 CCAAGGCTGGGGAAGCGTAGCCG No data
Right 1180843753 22:18970793-18970815 ACCGCAGTGCCGCGCCAGGCTGG No data
1180843741_1180843747 -10 Left 1180843741 22:18970754-18970776 CCAAGGCTGGGGAAGCGTAGCCG No data
Right 1180843747 22:18970767-18970789 AGCGTAGCCGGGCGGCCGGGAGG No data
1180843741_1180843755 17 Left 1180843741 22:18970754-18970776 CCAAGGCTGGGGAAGCGTAGCCG No data
Right 1180843755 22:18970794-18970816 CCGCAGTGCCGCGCCAGGCTGGG No data
1180843741_1180843751 12 Left 1180843741 22:18970754-18970776 CCAAGGCTGGGGAAGCGTAGCCG No data
Right 1180843751 22:18970789-18970811 GGCCACCGCAGTGCCGCGCCAGG No data
1180843741_1180843748 -9 Left 1180843741 22:18970754-18970776 CCAAGGCTGGGGAAGCGTAGCCG No data
Right 1180843748 22:18970768-18970790 GCGTAGCCGGGCGGCCGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180843741 Original CRISPR CGGCTACGCTTCCCCAGCCT TGG (reversed) Intergenic
No off target data available for this crispr