ID: 1180843749

View in Genome Browser
Species Human (GRCh38)
Location 22:18970774-18970796
Sequence CGGTGGCCCTCCCGGCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180843749_1180843766 24 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843766 22:18970821-18970843 AGGGCGCCCCGGCCCCGGGAGGG No data
1180843749_1180843761 13 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843761 22:18970810-18970832 GGCTGGGGCCAAGGGCGCCCCGG No data
1180843749_1180843767 27 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843767 22:18970824-18970846 GCGCCCCGGCCCCGGGAGGGCGG No data
1180843749_1180843757 4 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843757 22:18970801-18970823 GCCGCGCCAGGCTGGGGCCAAGG No data
1180843749_1180843763 20 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843763 22:18970817-18970839 GCCAAGGGCGCCCCGGCCCCGGG No data
1180843749_1180843755 -3 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843755 22:18970794-18970816 CCGCAGTGCCGCGCCAGGCTGGG No data
1180843749_1180843762 19 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843762 22:18970816-18970838 GGCCAAGGGCGCCCCGGCCCCGG No data
1180843749_1180843751 -8 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843751 22:18970789-18970811 GGCCACCGCAGTGCCGCGCCAGG No data
1180843749_1180843765 23 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843765 22:18970820-18970842 AAGGGCGCCCCGGCCCCGGGAGG No data
1180843749_1180843756 -2 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843756 22:18970795-18970817 CGCAGTGCCGCGCCAGGCTGGGG No data
1180843749_1180843753 -4 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843753 22:18970793-18970815 ACCGCAGTGCCGCGCCAGGCTGG No data
1180843749_1180843759 5 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180843749 Original CRISPR CGGTGGCCCTCCCGGCCGCC CGG (reversed) Intergenic
No off target data available for this crispr