ID: 1180843750

View in Genome Browser
Species Human (GRCh38)
Location 22:18970782-18970804
Sequence CGGCACTGCGGTGGCCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180843750_1180843762 11 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843762 22:18970816-18970838 GGCCAAGGGCGCCCCGGCCCCGG No data
1180843750_1180843766 16 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843766 22:18970821-18970843 AGGGCGCCCCGGCCCCGGGAGGG No data
1180843750_1180843765 15 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843765 22:18970820-18970842 AAGGGCGCCCCGGCCCCGGGAGG No data
1180843750_1180843759 -3 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG No data
1180843750_1180843771 25 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843771 22:18970830-18970852 CGGCCCCGGGAGGGCGGAGCCGG No data
1180843750_1180843763 12 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843763 22:18970817-18970839 GCCAAGGGCGCCCCGGCCCCGGG No data
1180843750_1180843767 19 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843767 22:18970824-18970846 GCGCCCCGGCCCCGGGAGGGCGG No data
1180843750_1180843773 28 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843773 22:18970833-18970855 CCCCGGGAGGGCGGAGCCGGAGG No data
1180843750_1180843756 -10 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843756 22:18970795-18970817 CGCAGTGCCGCGCCAGGCTGGGG No data
1180843750_1180843761 5 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843761 22:18970810-18970832 GGCTGGGGCCAAGGGCGCCCCGG No data
1180843750_1180843757 -4 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843757 22:18970801-18970823 GCCGCGCCAGGCTGGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180843750 Original CRISPR CGGCACTGCGGTGGCCCTCC CGG (reversed) Intergenic
No off target data available for this crispr