ID: 1180843759

View in Genome Browser
Species Human (GRCh38)
Location 22:18970802-18970824
Sequence CCGCGCCAGGCTGGGGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180843749_1180843759 5 Left 1180843749 22:18970774-18970796 CCGGGCGGCCGGGAGGGCCACCG No data
Right 1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG No data
1180843741_1180843759 25 Left 1180843741 22:18970754-18970776 CCAAGGCTGGGGAAGCGTAGCCG No data
Right 1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG No data
1180843750_1180843759 -3 Left 1180843750 22:18970782-18970804 CCGGGAGGGCCACCGCAGTGCCG No data
Right 1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180843759 Original CRISPR CCGCGCCAGGCTGGGGCCAA GGG Intergenic
No off target data available for this crispr