ID: 1180844079

View in Genome Browser
Species Human (GRCh38)
Location 22:18972060-18972082
Sequence CAGCCCTGGTGGGTGCGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180844079_1180844085 -4 Left 1180844079 22:18972060-18972082 CCACTCCGCACCCACCAGGGCTG No data
Right 1180844085 22:18972079-18972101 GCTGAGGCAGTGATAGATGATGG No data
1180844079_1180844090 20 Left 1180844079 22:18972060-18972082 CCACTCCGCACCCACCAGGGCTG No data
Right 1180844090 22:18972103-18972125 GGGCTGGAACCTGTCTGGTCAGG No data
1180844079_1180844087 0 Left 1180844079 22:18972060-18972082 CCACTCCGCACCCACCAGGGCTG No data
Right 1180844087 22:18972083-18972105 AGGCAGTGATAGATGATGGTGGG No data
1180844079_1180844088 4 Left 1180844079 22:18972060-18972082 CCACTCCGCACCCACCAGGGCTG No data
Right 1180844088 22:18972087-18972109 AGTGATAGATGATGGTGGGCTGG No data
1180844079_1180844091 21 Left 1180844079 22:18972060-18972082 CCACTCCGCACCCACCAGGGCTG No data
Right 1180844091 22:18972104-18972126 GGCTGGAACCTGTCTGGTCAGGG No data
1180844079_1180844089 15 Left 1180844079 22:18972060-18972082 CCACTCCGCACCCACCAGGGCTG No data
Right 1180844089 22:18972098-18972120 ATGGTGGGCTGGAACCTGTCTGG No data
1180844079_1180844086 -1 Left 1180844079 22:18972060-18972082 CCACTCCGCACCCACCAGGGCTG No data
Right 1180844086 22:18972082-18972104 GAGGCAGTGATAGATGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180844079 Original CRISPR CAGCCCTGGTGGGTGCGGAG TGG (reversed) Intergenic
No off target data available for this crispr