ID: 1180846783

View in Genome Browser
Species Human (GRCh38)
Location 22:18987316-18987338
Sequence ATACATATAAATAAGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180846779_1180846783 10 Left 1180846779 22:18987283-18987305 CCTGGGTGACAGAGTGAGACCCT 0: 6598
1: 26231
2: 68050
3: 126125
4: 184175
Right 1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG No data
1180846781_1180846783 -10 Left 1180846781 22:18987303-18987325 CCTGTCTTAAAAAATACATATAA No data
Right 1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG No data
1180846780_1180846783 -9 Left 1180846780 22:18987302-18987324 CCCTGTCTTAAAAAATACATATA No data
Right 1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG No data
1180846778_1180846783 14 Left 1180846778 22:18987279-18987301 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG No data
1180846777_1180846783 24 Left 1180846777 22:18987269-18987291 CCACTGTACTCCAGCCTGGGTGA 0: 6600
1: 96439
2: 183334
3: 206809
4: 172878
Right 1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180846783 Original CRISPR ATACATATAAATAAGTAGGC TGG Intergenic
No off target data available for this crispr