ID: 1180847376

View in Genome Browser
Species Human (GRCh38)
Location 22:18991246-18991268
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180847376_1180847384 5 Left 1180847376 22:18991246-18991268 CCGACCCGAGGCTGTCATGGGTA No data
Right 1180847384 22:18991274-18991296 TGCTGCTGGCCCCAGGGTTAGGG No data
1180847376_1180847389 27 Left 1180847376 22:18991246-18991268 CCGACCCGAGGCTGTCATGGGTA No data
Right 1180847389 22:18991296-18991318 GCTGCTCAGCCAGTCCTGGCTGG No data
1180847376_1180847388 23 Left 1180847376 22:18991246-18991268 CCGACCCGAGGCTGTCATGGGTA No data
Right 1180847388 22:18991292-18991314 TAGGGCTGCTCAGCCAGTCCTGG No data
1180847376_1180847380 -2 Left 1180847376 22:18991246-18991268 CCGACCCGAGGCTGTCATGGGTA No data
Right 1180847380 22:18991267-18991289 TAGTGCCTGCTGCTGGCCCCAGG 0: 2
1: 0
2: 1
3: 32
4: 300
1180847376_1180847379 -9 Left 1180847376 22:18991246-18991268 CCGACCCGAGGCTGTCATGGGTA No data
Right 1180847379 22:18991260-18991282 TCATGGGTAGTGCCTGCTGCTGG 0: 2
1: 0
2: 0
3: 12
4: 152
1180847376_1180847383 4 Left 1180847376 22:18991246-18991268 CCGACCCGAGGCTGTCATGGGTA No data
Right 1180847383 22:18991273-18991295 CTGCTGCTGGCCCCAGGGTTAGG No data
1180847376_1180847381 -1 Left 1180847376 22:18991246-18991268 CCGACCCGAGGCTGTCATGGGTA No data
Right 1180847381 22:18991268-18991290 AGTGCCTGCTGCTGGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180847376 Original CRISPR TACCCATGACAGCCTCGGGT CGG (reversed) Intergenic
No off target data available for this crispr