ID: 1180847378

View in Genome Browser
Species Human (GRCh38)
Location 22:18991251-18991273
Sequence GGCACTACCCATGACAGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180847378_1180847384 0 Left 1180847378 22:18991251-18991273 CCGAGGCTGTCATGGGTAGTGCC 0: 2
1: 0
2: 0
3: 9
4: 134
Right 1180847384 22:18991274-18991296 TGCTGCTGGCCCCAGGGTTAGGG No data
1180847378_1180847389 22 Left 1180847378 22:18991251-18991273 CCGAGGCTGTCATGGGTAGTGCC 0: 2
1: 0
2: 0
3: 9
4: 134
Right 1180847389 22:18991296-18991318 GCTGCTCAGCCAGTCCTGGCTGG No data
1180847378_1180847388 18 Left 1180847378 22:18991251-18991273 CCGAGGCTGTCATGGGTAGTGCC 0: 2
1: 0
2: 0
3: 9
4: 134
Right 1180847388 22:18991292-18991314 TAGGGCTGCTCAGCCAGTCCTGG No data
1180847378_1180847380 -7 Left 1180847378 22:18991251-18991273 CCGAGGCTGTCATGGGTAGTGCC 0: 2
1: 0
2: 0
3: 9
4: 134
Right 1180847380 22:18991267-18991289 TAGTGCCTGCTGCTGGCCCCAGG 0: 2
1: 0
2: 1
3: 32
4: 300
1180847378_1180847383 -1 Left 1180847378 22:18991251-18991273 CCGAGGCTGTCATGGGTAGTGCC 0: 2
1: 0
2: 0
3: 9
4: 134
Right 1180847383 22:18991273-18991295 CTGCTGCTGGCCCCAGGGTTAGG No data
1180847378_1180847390 27 Left 1180847378 22:18991251-18991273 CCGAGGCTGTCATGGGTAGTGCC 0: 2
1: 0
2: 0
3: 9
4: 134
Right 1180847390 22:18991301-18991323 TCAGCCAGTCCTGGCTGGAAAGG No data
1180847378_1180847381 -6 Left 1180847378 22:18991251-18991273 CCGAGGCTGTCATGGGTAGTGCC 0: 2
1: 0
2: 0
3: 9
4: 134
Right 1180847381 22:18991268-18991290 AGTGCCTGCTGCTGGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180847378 Original CRISPR GGCACTACCCATGACAGCCT CGG (reversed) Intergenic
900701099 1:4049128-4049150 GGCAAGACCCATGCCAGGCTGGG - Intergenic
901562490 1:10083783-10083805 GGAAGTACCCATGCCAGCATAGG - Intronic
903177821 1:21591075-21591097 GGCGCTTCCCAGAACAGCCTCGG + Intergenic
904038629 1:27571736-27571758 GGCACACACCATGCCAGCCTGGG - Intronic
904306635 1:29594215-29594237 GGCAGTACCCAGGCCAGGCTGGG + Intergenic
904999225 1:34655237-34655259 GACACTAGCCAGGACTGCCTGGG - Intergenic
906037698 1:42762634-42762656 GGAACTACCCACGACAGATTAGG + Intronic
906703393 1:47876362-47876384 GGGACTTCCCATGGCAACCTGGG + Intronic
908194647 1:61737008-61737030 GCCACTACACACCACAGCCTGGG - Intergenic
908748539 1:67398231-67398253 GGCACAAACCATGACAGACAAGG + Intergenic
909548821 1:76876279-76876301 GGCCATAGCCATGTCAGCCTTGG + Intronic
911627375 1:100140074-100140096 GGCAAATCCCATGACAGCTTAGG - Intronic
916576378 1:166070575-166070597 GGCACTGCCCATGTCACACTGGG + Exonic
919316103 1:195971882-195971904 GGAACTGCCCAGAACAGCCTGGG + Intergenic
920197563 1:204239275-204239297 GGCCATAGCCAGGACAGCCTTGG - Intronic
1062920333 10:1274245-1274267 GGCAGTGGCCATGGCAGCCTGGG + Intronic
1063515004 10:6687200-6687222 GGCACTGGCCAAAACAGCCTGGG - Intergenic
1067044901 10:42980063-42980085 GGCACTGGCCATGACAACCTTGG - Intergenic
1067263140 10:44712255-44712277 GTCACTACCCACTTCAGCCTAGG - Intergenic
1070529445 10:77323896-77323918 GGATTTACCTATGACAGCCTTGG - Intronic
1076194259 10:128504236-128504258 GCCACTGCACATGAGAGCCTGGG - Intergenic
1076551108 10:131278706-131278728 GGCACCCCCCAGGCCAGCCTTGG - Intronic
1077359597 11:2134831-2134853 GGCACCCCCCACGGCAGCCTTGG + Intronic
1078977560 11:16495592-16495614 GGCAGTAACTATGACAGGCTTGG - Intronic
1079751601 11:24206294-24206316 AACAATACCCATGACAGCATTGG + Intergenic
1087700237 11:101429220-101429242 GGCATTATCCATGACTGCTTTGG - Intergenic
1089584552 11:119502241-119502263 GGCTCTCTCCAAGACAGCCTCGG + Intergenic
1092915094 12:13182457-13182479 GGCAGTCCCCATCACAGCATTGG + Intergenic
1093981480 12:25479903-25479925 GGCCGTAGCCATGTCAGCCTTGG + Intronic
1096536026 12:52275281-52275303 AGCACTTCCCATAGCAGCCTTGG + Intronic
1099350760 12:81565821-81565843 GGCATTACCCATGACATTTTTGG - Intronic
1099438047 12:82667037-82667059 AGAACTACACATGACAGTCTTGG + Intergenic
1104425883 12:128677717-128677739 GGCACTGCCCAGGACAGGGTGGG + Intronic
1105967386 13:25397116-25397138 GGCACTGACCAGAACAGCCTAGG - Intronic
1108317088 13:49247626-49247648 AACACTGACCATGACAGCCTGGG + Intergenic
1109519152 13:63485696-63485718 GGCCGTAGCCAGGACAGCCTTGG - Intergenic
1111088864 13:83415088-83415110 GCCACCACACATGCCAGCCTGGG + Intergenic
1118050510 14:62021333-62021355 GGCCACACCCATGACAGCCAAGG - Intronic
1118880645 14:69823121-69823143 GGCCGTAGCCATGTCAGCCTTGG + Intergenic
1119059577 14:71461301-71461323 GGCCGTAGCCAGGACAGCCTTGG + Intronic
1119807656 14:77492657-77492679 TGCACTACCCATGCCTGGCTTGG + Intronic
1120986691 14:90341442-90341464 GGCAGTTTCCATGACACCCTCGG - Intergenic
1121606874 14:95247060-95247082 GGCCAGAACCATGACAGCCTGGG + Intronic
1124615465 15:31238659-31238681 GGCACTATTCACGACAGCCAAGG - Intergenic
1132002449 15:98193636-98193658 AGCACTACCCTAGACAGCCACGG + Intergenic
1134231272 16:12432435-12432457 AGCACTCCCCATACCAGCCTGGG - Intronic
1148457103 17:47816921-47816943 GGCAGAAACCATCACAGCCTGGG + Intronic
1148554016 17:48567077-48567099 GCCTCTACCCATCCCAGCCTTGG + Intronic
1148749527 17:49936574-49936596 TGGAGAACCCATGACAGCCTAGG + Intergenic
1150007558 17:61479217-61479239 GGCACCTCCTATCACAGCCTGGG - Intronic
1150690993 17:67366667-67366689 GGCACTGCCGCGGACAGCCTGGG + Intergenic
1151954724 17:77374546-77374568 GGCTCTGCCCAAGTCAGCCTAGG - Intronic
1154036117 18:10804031-10804053 GGCAGTTCCCTAGACAGCCTGGG + Intronic
1155678934 18:28465919-28465941 GGAACTGTCCATGACAGCCTAGG - Intergenic
1158677858 18:59538585-59538607 GGTGCTACACATGACATCCTGGG + Intronic
1163155992 19:15440216-15440238 GGGCCTACCCACGTCAGCCTCGG - Intronic
1165097029 19:33415020-33415042 GGCACTGCCCTTGCCTGCCTTGG - Intronic
1166073065 19:40397815-40397837 GACAGGACCCTTGACAGCCTCGG + Exonic
1167613028 19:50516535-50516557 GCCACCAGCCAGGACAGCCTGGG + Intergenic
928639209 2:33280133-33280155 GGCACTGTCCATTCCAGCCTCGG - Exonic
928683172 2:33723907-33723929 GGCCCTGCCCATGACATTCTAGG + Intergenic
931254319 2:60556720-60556742 GGCACTTCCCATTTCACCCTGGG - Intergenic
931579224 2:63754745-63754767 GGCAATACTCATGAGAGTCTTGG - Intronic
934517962 2:95000538-95000560 GACCCTACTCATGCCAGCCTGGG + Intergenic
935869457 2:107429476-107429498 GGCACTACAGACAACAGCCTAGG - Intergenic
937852444 2:126647844-126647866 GGCTATAGCCATGTCAGCCTTGG + Intergenic
939213996 2:139213129-139213151 GGCCATAGCCATGTCAGCCTTGG - Intergenic
941283874 2:163584907-163584929 GGAACTGCCCATGACATCATAGG - Intergenic
942735766 2:179111034-179111056 TGTTCTACCCATGTCAGCCTAGG - Intronic
944396681 2:199275620-199275642 GCAACTGCCCATGACAGACTAGG + Intronic
946109910 2:217405716-217405738 GGCACCACCCAGGAGAGCCTTGG - Intronic
948567830 2:238897765-238897787 GGCACTGCCCATCCCAGCCCGGG + Intronic
1173906980 20:46636657-46636679 GGCACTTCCCTTGCCAGCCTCGG - Intronic
1174069017 20:47887055-47887077 GGCAATACCCCTGACACTCTAGG - Intergenic
1174407507 20:50311720-50311742 GGCAGAACCCATTGCAGCCTGGG + Intergenic
1178143680 21:29714600-29714622 GGCACTACCCAGTCCTGCCTGGG - Intronic
1178295944 21:31409986-31410008 GGCACTACACGAGACAGCCAGGG + Intronic
1180847378 22:18991251-18991273 GGCACTACCCATGACAGCCTCGG - Intergenic
1182965834 22:34520190-34520212 GGCACTAGCCAGGTCAGCCTTGG - Intergenic
1184402996 22:44284737-44284759 TGCACTACCCAGGGCCGCCTGGG + Intronic
1184733043 22:46381505-46381527 GGCACTACCCATGACAGCCTTGG + Intronic
953408040 3:42669677-42669699 GCCACCACAGATGACAGCCTTGG + Intergenic
953994842 3:47512043-47512065 GGCACTTCCAAAGTCAGCCTAGG - Intronic
954649248 3:52150220-52150242 GGCCCTTCCCATGCTAGCCTTGG + Intronic
958863510 3:99472255-99472277 GGCACCAGCCATCACAGACTTGG - Intergenic
961574341 3:127822769-127822791 GGCATTTCCGATGACAGCTTCGG - Exonic
964174221 3:153805998-153806020 GGCACTACCCAAGACGGAGTAGG - Intergenic
965605509 3:170494400-170494422 GGAGCTAACCATGCCAGCCTTGG - Intronic
966769927 3:183494573-183494595 GGCAGGACCCAAGCCAGCCTGGG + Intronic
967905518 3:194496203-194496225 GAAATTCCCCATGACAGCCTAGG - Intronic
968913735 4:3488193-3488215 GGCACTGCCCCGGTCAGCCTGGG - Intronic
969505313 4:7583097-7583119 GGCCCTGCCCAGGTCAGCCTGGG + Intronic
969692088 4:8709351-8709373 GGCAGAACCCGTGCCAGCCTCGG - Intergenic
975741944 4:77437600-77437622 GGCAAATCCCATGACAGGCTGGG - Intergenic
976704095 4:88004020-88004042 TTCCCTACCCATGCCAGCCTGGG + Intergenic
978962181 4:114693854-114693876 GGCATTATATATGACAGCCTTGG + Intergenic
983715545 4:170777041-170777063 AGCACTCCCCATGCCAACCTTGG + Intergenic
984091333 4:175378782-175378804 GACACTACGCATCACAGCCAGGG + Intergenic
984704655 4:182838978-182839000 GCCACTACCCAAGACTGCCTTGG + Intergenic
985622642 5:963505-963527 GGCTCTGCCCGTGACAGCCCCGG + Intergenic
990527097 5:56638771-56638793 GGCACTTCCCAGCACAGCCCGGG - Intergenic
993295988 5:86141337-86141359 TGCTCTACCAATGACAGGCTGGG + Intergenic
995198667 5:109401297-109401319 ACCACCACCAATGACAGCCTGGG + Intronic
998964716 5:147526852-147526874 GGCAGTACACAAGACAGCTTTGG - Intergenic
1002453086 5:179330756-179330778 GACACAGCCCGTGACAGCCTGGG + Intronic
1003285987 6:4734358-4734380 AGCTCTCCCCATCACAGCCTGGG + Intronic
1003648124 6:7932812-7932834 GGAACTGCCCAGGACAGCCCAGG - Intronic
1006504111 6:34476904-34476926 GGCACCCCCCAGGACTGCCTTGG + Intronic
1006615373 6:35322527-35322549 GGCAGTAGCCATGACAGACATGG - Intergenic
1007580645 6:42957454-42957476 GGCACCACTCATTCCAGCCTGGG + Intergenic
1010084401 6:71899923-71899945 GGCACTACTCATGATATGCTAGG + Intronic
1010707116 6:79128005-79128027 GGCACTACCCATCAGAGTTTAGG + Intergenic
1010799490 6:80158580-80158602 TGCAAGACCAATGACAGCCTTGG + Intronic
1011315980 6:86031852-86031874 TGCATTCCCCATGCCAGCCTTGG + Intergenic
1011650140 6:89498393-89498415 GGCACTACCTATGACAATCTGGG + Intronic
1013663144 6:112319143-112319165 GGCACAATGGATGACAGCCTCGG - Intergenic
1014295715 6:119614471-119614493 GGCCCTACCCATGCCAGCAAAGG - Intergenic
1018473144 6:164113955-164113977 GGAACTTGTCATGACAGCCTTGG - Intergenic
1019411419 7:908396-908418 GGCACCATCCAAGACAGCCCAGG - Intronic
1020413334 7:7917238-7917260 GTCACTATTTATGACAGCCTAGG - Intronic
1027129523 7:75581190-75581212 GGTAGTTCCCATGAGAGCCTGGG + Intronic
1031787200 7:126047534-126047556 CTCACTACCCTTCACAGCCTCGG - Intergenic
1032237744 7:130139993-130140015 GGCTCTCACCATGACTGCCTAGG + Intergenic
1032872594 7:136002226-136002248 GCCACTGCCCAGGTCAGCCTGGG - Intergenic
1034563662 7:151896957-151896979 GGAACAACCCCTGAAAGCCTGGG - Intergenic
1035322724 7:158044002-158044024 CTCACTGCCCATCACAGCCTCGG - Intronic
1039817430 8:41106891-41106913 AGCCCTACCTATGACAGCCCAGG - Intergenic
1047770796 8:128028316-128028338 CGCAATACCCATGCCAGCCGAGG - Intergenic
1055903813 9:81270302-81270324 GGCTGTAGCCATGTCAGCCTTGG + Intergenic
1057008421 9:91581166-91581188 GGAACTTCCCAAGACAGCCATGG - Intronic
1058124702 9:101178269-101178291 GGCAGTAGCCAGGTCAGCCTTGG - Intronic
1058630068 9:106977282-106977304 TGCTCTATCCATGACATCCTTGG + Intronic
1058773019 9:108256888-108256910 GGCACTGCTCATGATAGCCTTGG + Intergenic
1058778729 9:108311733-108311755 GGGACTATCCTTGACAGTCTAGG + Intergenic
1061565865 9:131439521-131439543 TGCACTACCCCTGCCAGCCAAGG + Intronic
1186383971 X:9090886-9090908 GGCTGTAGCCATGTCAGCCTTGG + Intronic
1191933032 X:66395034-66395056 GGCCGTACCCAGGTCAGCCTTGG - Intergenic
1192673133 X:73167519-73167541 GGCAGTAGCCAGGTCAGCCTTGG + Intergenic
1192896405 X:75447107-75447129 GGCAGTAGCCAGGTCAGCCTTGG - Intronic
1192996301 X:76516466-76516488 GGCAGTAACCAGGTCAGCCTTGG - Intergenic
1193597805 X:83469266-83469288 GGCACTTCCCAAGACAGCACAGG + Intergenic
1196851166 X:119940296-119940318 GCCACTGCACATGACAGCCTGGG + Intronic
1197847960 X:130823830-130823852 GGCACTACCAATGACACTCAAGG + Intronic
1198190522 X:134299799-134299821 GGCAGTACTCCTCACAGCCTAGG + Intergenic
1200068955 X:153518359-153518381 GGCACTGCCCATGACCGCGGTGG - Intronic