ID: 1180847382

View in Genome Browser
Species Human (GRCh38)
Location 22:18991272-18991294
Sequence CTAACCCTGGGGCCAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180847382_1180847389 1 Left 1180847382 22:18991272-18991294 CCTGCTGCTGGCCCCAGGGTTAG No data
Right 1180847389 22:18991296-18991318 GCTGCTCAGCCAGTCCTGGCTGG No data
1180847382_1180847390 6 Left 1180847382 22:18991272-18991294 CCTGCTGCTGGCCCCAGGGTTAG No data
Right 1180847390 22:18991301-18991323 TCAGCCAGTCCTGGCTGGAAAGG No data
1180847382_1180847388 -3 Left 1180847382 22:18991272-18991294 CCTGCTGCTGGCCCCAGGGTTAG No data
Right 1180847388 22:18991292-18991314 TAGGGCTGCTCAGCCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180847382 Original CRISPR CTAACCCTGGGGCCAGCAGC AGG (reversed) Intergenic
No off target data available for this crispr