ID: 1180847388

View in Genome Browser
Species Human (GRCh38)
Location 22:18991292-18991314
Sequence TAGGGCTGCTCAGCCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180847382_1180847388 -3 Left 1180847382 22:18991272-18991294 CCTGCTGCTGGCCCCAGGGTTAG No data
Right 1180847388 22:18991292-18991314 TAGGGCTGCTCAGCCAGTCCTGG No data
1180847377_1180847388 19 Left 1180847377 22:18991250-18991272 CCCGAGGCTGTCATGGGTAGTGC No data
Right 1180847388 22:18991292-18991314 TAGGGCTGCTCAGCCAGTCCTGG No data
1180847378_1180847388 18 Left 1180847378 22:18991251-18991273 CCGAGGCTGTCATGGGTAGTGCC 0: 2
1: 0
2: 0
3: 9
4: 134
Right 1180847388 22:18991292-18991314 TAGGGCTGCTCAGCCAGTCCTGG No data
1180847376_1180847388 23 Left 1180847376 22:18991246-18991268 CCGACCCGAGGCTGTCATGGGTA No data
Right 1180847388 22:18991292-18991314 TAGGGCTGCTCAGCCAGTCCTGG No data
1180847375_1180847388 24 Left 1180847375 22:18991245-18991267 CCCGACCCGAGGCTGTCATGGGT No data
Right 1180847388 22:18991292-18991314 TAGGGCTGCTCAGCCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180847388 Original CRISPR TAGGGCTGCTCAGCCAGTCC TGG Intergenic
No off target data available for this crispr