ID: 1180848259

View in Genome Browser
Species Human (GRCh38)
Location 22:18996217-18996239
Sequence TAAGAAATGCATAATAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180848255_1180848259 7 Left 1180848255 22:18996187-18996209 CCTGTTTTTTAAAGACATGTTCA No data
Right 1180848259 22:18996217-18996239 TAAGAAATGCATAATAAGGTGGG No data
1180848254_1180848259 11 Left 1180848254 22:18996183-18996205 CCAGCCTGTTTTTTAAAGACATG No data
Right 1180848259 22:18996217-18996239 TAAGAAATGCATAATAAGGTGGG No data
1180848252_1180848259 20 Left 1180848252 22:18996174-18996196 CCACTGTGCCCAGCCTGTTTTTT 0: 29
1: 374
2: 2220
3: 8363
4: 25182
Right 1180848259 22:18996217-18996239 TAAGAAATGCATAATAAGGTGGG No data
1180848253_1180848259 12 Left 1180848253 22:18996182-18996204 CCCAGCCTGTTTTTTAAAGACAT No data
Right 1180848259 22:18996217-18996239 TAAGAAATGCATAATAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180848259 Original CRISPR TAAGAAATGCATAATAAGGT GGG Intergenic
No off target data available for this crispr