ID: 1180848386

View in Genome Browser
Species Human (GRCh38)
Location 22:18997205-18997227
Sequence CCCCTACAGTTCCATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 688
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 658}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180848386_1180848392 -1 Left 1180848386 22:18997205-18997227 CCTGCCCCATGGAACTGTAGGGG 0: 1
1: 0
2: 1
3: 28
4: 658
Right 1180848392 22:18997227-18997249 GCTTACGAAGGCATTTCGTTTGG 0: 1
1: 0
2: 0
3: 6
4: 41
1180848386_1180848399 26 Left 1180848386 22:18997205-18997227 CCTGCCCCATGGAACTGTAGGGG 0: 1
1: 0
2: 1
3: 28
4: 658
Right 1180848399 22:18997254-18997276 GGAGCTCATCCAGGAGGACTGGG 0: 1
1: 0
2: 9
3: 23
4: 211
1180848386_1180848395 5 Left 1180848386 22:18997205-18997227 CCTGCCCCATGGAACTGTAGGGG 0: 1
1: 0
2: 1
3: 28
4: 658
Right 1180848395 22:18997233-18997255 GAAGGCATTTCGTTTGGGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 183
1180848386_1180848398 25 Left 1180848386 22:18997205-18997227 CCTGCCCCATGGAACTGTAGGGG 0: 1
1: 0
2: 1
3: 28
4: 658
Right 1180848398 22:18997253-18997275 AGGAGCTCATCCAGGAGGACTGG 0: 1
1: 0
2: 9
3: 20
4: 294
1180848386_1180848393 0 Left 1180848386 22:18997205-18997227 CCTGCCCCATGGAACTGTAGGGG 0: 1
1: 0
2: 1
3: 28
4: 658
Right 1180848393 22:18997228-18997250 CTTACGAAGGCATTTCGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 62
1180848386_1180848397 20 Left 1180848386 22:18997205-18997227 CCTGCCCCATGGAACTGTAGGGG 0: 1
1: 0
2: 1
3: 28
4: 658
Right 1180848397 22:18997248-18997270 GGGGAAGGAGCTCATCCAGGAGG 0: 1
1: 0
2: 5
3: 49
4: 307
1180848386_1180848396 17 Left 1180848386 22:18997205-18997227 CCTGCCCCATGGAACTGTAGGGG 0: 1
1: 0
2: 1
3: 28
4: 658
Right 1180848396 22:18997245-18997267 TTTGGGGAAGGAGCTCATCCAGG 0: 1
1: 0
2: 2
3: 27
4: 264
1180848386_1180848394 1 Left 1180848386 22:18997205-18997227 CCTGCCCCATGGAACTGTAGGGG 0: 1
1: 0
2: 1
3: 28
4: 658
Right 1180848394 22:18997229-18997251 TTACGAAGGCATTTCGTTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180848386 Original CRISPR CCCCTACAGTTCCATGGGGC AGG (reversed) Intergenic
900334490 1:2154994-2155016 CCCTAACAGTTCCAGGAGGCAGG - Intronic
900543682 1:3216796-3216818 CCCCTCCAGTTCCATGCTGATGG - Intronic
900776324 1:4588221-4588243 CCCTTACAGATACATGGGGAAGG + Intergenic
901159118 1:7161668-7161690 GACTTACAGTTCCATGTGGCTGG - Intronic
901291299 1:8126368-8126390 GACTTACAGTTCCATGTGGCTGG + Intergenic
901351403 1:8600202-8600224 CTCTCACAGTTCCATGTGGCTGG - Intronic
902512334 1:16973166-16973188 CCCCATCTGTTCCATGGGCCGGG - Intergenic
902643924 1:17784892-17784914 GACTTACAGTTCCATGTGGCTGG + Intronic
902791225 1:18769522-18769544 ACTCCAAAGTTCCATGGGGCTGG - Intergenic
903003907 1:20285781-20285803 GGCTTACAGTTCCATGTGGCTGG - Intergenic
903335489 1:22621731-22621753 GCCCCACAGCCCCATGGGGCAGG + Intergenic
905290125 1:36915776-36915798 CACTTACAGTTCCATGTGGCTGG - Intronic
905290386 1:36917683-36917705 GACTTACAGTTCCATGTGGCTGG - Intronic
905708615 1:40081672-40081694 GACTTACAGTTCCATGTGGCTGG - Intronic
906036233 1:42751727-42751749 GACTTACAGTTCCATGTGGCTGG - Intronic
906459264 1:46024911-46024933 GACTTACAGTTCCATGTGGCTGG + Intronic
907721059 1:56972626-56972648 AACTTACAGTTCCATGTGGCTGG - Intergenic
907771679 1:57471708-57471730 GACTTACAGTTCCATGTGGCTGG - Intronic
908537019 1:65087792-65087814 GACTTACAGTTCCATGTGGCTGG - Intergenic
908936370 1:69382297-69382319 GACTTACAGTTCCATGTGGCTGG + Intergenic
909096249 1:71291936-71291958 GACTTACAGTTCCATGTGGCTGG - Intergenic
909105333 1:71398991-71399013 GACCTACAGTTCCATGTGGCTGG - Exonic
909200600 1:72686609-72686631 GACTTACAGTTCCATGTGGCCGG + Intergenic
909360683 1:74756086-74756108 AACTTACAGTTCCATGTGGCTGG - Intronic
909371074 1:74884285-74884307 GACTTACAGTTCCATGTGGCTGG - Intergenic
909718735 1:78740833-78740855 GACTTACAGTTCCATGTGGCTGG - Intergenic
909755417 1:79219973-79219995 AACTTACAGTTCCATGTGGCTGG - Intergenic
910233060 1:85007070-85007092 CGCTTACAGTTCCATGTGGTTGG + Intronic
910233387 1:85009307-85009329 GACTTACAGTTCCATGTGGCTGG + Intronic
910447201 1:87310475-87310497 ATTCTACAATTCCATGGGGCTGG - Intergenic
911246408 1:95523122-95523144 TACTTACAGTTCCATGTGGCTGG - Intergenic
911260510 1:95679897-95679919 CACCTACCCTTCCTTGGGGCTGG + Intergenic
911307976 1:96254699-96254721 GACTTACAGTTCCATGTGGCTGG - Intergenic
911455974 1:98124075-98124097 GACTTACAGTTCCATGTGGCTGG - Intergenic
911600239 1:99840615-99840637 GACTTACAGTTCCATGTGGCTGG - Intergenic
911951071 1:104173995-104174017 GCCTCACAGTTCCATGTGGCTGG + Intergenic
912078726 1:105910494-105910516 ACCCAACAGCTACATGGGGCAGG + Intergenic
912080775 1:105933025-105933047 GACTTACAGTTCCATGGGGCTGG - Intergenic
912319351 1:108696288-108696310 CCCCTACAGATCTGTGGGACTGG + Exonic
912635690 1:111290501-111290523 CCCTTACAGATACATGGGGAAGG - Intergenic
912974265 1:114313941-114313963 GCCTCACAGTTCCATGTGGCTGG + Intergenic
913307941 1:117451748-117451770 GCCTTACAGTTCCACGTGGCTGG - Intronic
914523618 1:148440201-148440223 GACTTACAGTTCCATGTGGCTGG - Intergenic
916411741 1:164553092-164553114 GACTTACAGTTCCATGTGGCTGG + Intergenic
916910609 1:169341651-169341673 CCCCTACAGATCCACAGGGAAGG + Intronic
917411884 1:174767821-174767843 GACTTACAGTTCCATGTGGCTGG + Intronic
917690448 1:177462980-177463002 AGCTTACAGTTCCATGTGGCTGG + Intergenic
917759069 1:178135724-178135746 GACTTACAGTTCCATGTGGCTGG + Intronic
918691613 1:187487701-187487723 AACTTACAGTTCCATGTGGCTGG + Intergenic
918718254 1:187819076-187819098 AACTTACAGTTCCATGTGGCTGG + Intergenic
918871347 1:189978482-189978504 GACTTACAGTTCCATGTGGCTGG + Intergenic
919040841 1:192386119-192386141 GACTTACAGTTCCATGTGGCTGG - Intergenic
920039442 1:203085947-203085969 CTCATACAGCTCCATGGGGTCGG + Exonic
920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG + Intronic
920597810 1:207290894-207290916 GACTTACAGTTCCATGTGGCTGG - Intergenic
920788763 1:209068296-209068318 TCCCTACAGTTAAATGGGGTTGG + Intergenic
921466244 1:215491772-215491794 GACTTACAGTTCCATGTGGCTGG - Intergenic
922164241 1:223101618-223101640 GACTTACAGTTCCATGTGGCTGG - Intergenic
923757973 1:236811058-236811080 GACTTACAGTTCCATGTGGCTGG + Intronic
924175240 1:241384957-241384979 GACTTACAGTTCCATGTGGCTGG + Intergenic
1063045128 10:2384138-2384160 GGCTTACAGTTCCATGTGGCTGG - Intergenic
1063172080 10:3517889-3517911 GACTTACAGTTCCATGTGGCTGG - Intergenic
1064534843 10:16348056-16348078 GCCTTACAGTTCCACGTGGCTGG - Intergenic
1064686316 10:17866051-17866073 TCCTTACAGTTCTATGAGGCAGG + Intronic
1064876194 10:19996738-19996760 GACTTACAGTTCCATGTGGCTGG + Intronic
1065252720 10:23832822-23832844 GACTTACAGTTCCATGTGGCTGG + Intronic
1065507773 10:26446668-26446690 CCCCTACACTGGCATGGGGTTGG - Intronic
1065642174 10:27794404-27794426 GACTCACAGTTCCATGGGGCTGG - Intergenic
1066116807 10:32247838-32247860 GACTTACAGTTCCATGTGGCTGG - Intergenic
1066273431 10:33845450-33845472 AACTTACAGTTCCATGTGGCTGG + Intergenic
1066392145 10:34986206-34986228 GACTTACAGTTCCATGTGGCTGG + Intergenic
1067665955 10:48279480-48279502 GACTTACAGTTCCATGTGGCTGG + Intergenic
1068265720 10:54646512-54646534 TTCCTAAAGTTCCAGGGGGCGGG + Intronic
1069055466 10:63840012-63840034 GCCTCACAGTTCCATGTGGCTGG - Intergenic
1069121132 10:64570742-64570764 GACTTACAGTTCCATGTGGCTGG - Intergenic
1069628032 10:69880366-69880388 CCTCTCCTGTCCCATGGGGCCGG + Intronic
1069792291 10:71030463-71030485 CCCCTTCTTTTCCATGGGGCTGG + Intergenic
1069805342 10:71118972-71118994 GACTTACAGTTCCATGTGGCTGG - Intergenic
1070376134 10:75832695-75832717 GACTTACAGTTCCATGTGGCTGG + Intronic
1070655908 10:78271080-78271102 CCCCTACAGTCTCAGGGTGCTGG + Intergenic
1070714478 10:78709263-78709285 GACTTACAGTTCCATGTGGCTGG + Intergenic
1071246737 10:83773346-83773368 GACTTACAGTTCCATGTGGCTGG + Intergenic
1071873570 10:89819941-89819963 CGCTCACAGTTCCATGTGGCTGG + Intergenic
1071941996 10:90600847-90600869 GACTTACAGTTCCATGTGGCTGG - Intergenic
1072010557 10:91299371-91299393 CCCCCACAGATCCATGGGGTGGG - Intergenic
1072264465 10:93714041-93714063 CCCCTGCTGTTCTGTGGGGCTGG + Intergenic
1072888590 10:99301518-99301540 GACTTACAGTTCCATGTGGCTGG - Intergenic
1073386889 10:103133243-103133265 GACTTACAGTTCCATGTGGCTGG - Intronic
1074215495 10:111380103-111380125 CCCATTCTGTTCCATGGGGGTGG - Intergenic
1074337139 10:112589441-112589463 GACTTACAGTTCCATGTGGCTGG - Intronic
1076073392 10:127512022-127512044 AACTTACAGTTCCATGCGGCTGG - Intergenic
1076155535 10:128202314-128202336 GACTTACAGTTCCATGTGGCTGG + Intergenic
1077425793 11:2475902-2475924 GACTTACAGTTCCATGTGGCTGG - Intronic
1077961099 11:7077617-7077639 GACTTACAGTTCCATGTGGCTGG + Intergenic
1078364054 11:10692442-10692464 CCCCAACAGTTCTATGGGGGAGG - Intronic
1078482091 11:11686605-11686627 CACTTACAGTTCCACGTGGCCGG - Intergenic
1079181535 11:18197976-18197998 GACTTACAGTTCCATGTGGCTGG - Intronic
1079652237 11:22943611-22943633 GACTTACAGTTCCATGTGGCTGG + Intergenic
1079654892 11:22975052-22975074 AACTTACAGTTCCATGTGGCTGG - Intergenic
1079686115 11:23362150-23362172 GACTTACAGTTCCATGTGGCTGG + Intergenic
1079709463 11:23663609-23663631 GACTTACAGTTCCATGTGGCTGG - Intergenic
1079880437 11:25920935-25920957 GACTTACAGTTCCATGTGGCTGG + Intergenic
1080909945 11:36586284-36586306 GTCTTACAGTTCCATGAGGCTGG + Intronic
1080958414 11:37129466-37129488 AACTTACAGTTCCATGTGGCTGG - Intergenic
1080991912 11:37546594-37546616 GACTTACAGTTCCATGTGGCTGG + Intergenic
1081267895 11:41049338-41049360 CACTCACAGTTCCATGTGGCTGG - Intronic
1082085363 11:48045433-48045455 CCCACTCAGTTCCATGTGGCAGG - Intronic
1083205528 11:61146554-61146576 CCACTGCAGATCCAAGGGGCTGG + Intronic
1083279174 11:61615113-61615135 GACTTACAGTTCCATGTGGCTGG - Intergenic
1083307927 11:61770427-61770449 CCACTACGCTGCCATGGGGCAGG + Exonic
1083611080 11:64004621-64004643 CCCCTACCATCCCGTGGGGCTGG + Intronic
1084697300 11:70763320-70763342 CCCCTGCTGTCCCATGGGGATGG - Intronic
1085588367 11:77732758-77732780 GACTTACAGTTCCATGTGGCTGG - Intronic
1086314810 11:85580182-85580204 GACTTACAGTTCCATGTGGCTGG - Intronic
1086334192 11:85783150-85783172 GACTTACAGTTCCATGTGGCTGG + Intronic
1086604883 11:88684875-88684897 GACTTACAGTTCCATGTGGCTGG - Intronic
1087474755 11:98621426-98621448 GACCTACAGTTCCATGTGGCTGG - Intergenic
1088090059 11:106027278-106027300 GACTTACAGTTCCATGTGGCTGG - Intergenic
1088377497 11:109158775-109158797 GCCTTACAGTTCCACGTGGCTGG + Intergenic
1088426808 11:109713765-109713787 GACTTACAGTTCCATGTGGCTGG + Intergenic
1088531610 11:110816668-110816690 GACTTACAGTTCCATGTGGCTGG - Intergenic
1088706194 11:112466659-112466681 GACTCACAGTTCCATGGGGCTGG + Intergenic
1088987993 11:114926932-114926954 GCCTTACAGTTCCATGTGGCTGG - Intergenic
1089512255 11:119006965-119006987 CTCACACAGTTCCATGTGGCCGG - Intronic
1089757243 11:120695924-120695946 CTCCTACTGGTCCATGGAGCAGG - Intronic
1089851974 11:121506362-121506384 GACTTACAGTTCCATGTGGCTGG + Intronic
1090087970 11:123667791-123667813 GACTTACAGTTCCATGTGGCTGG - Intergenic
1090572846 11:128067269-128067291 GACTTACAGTTCCATGTGGCTGG + Intergenic
1090600901 11:128370179-128370201 GACTTACAGTTCCATGTGGCTGG + Intergenic
1091089273 11:132754481-132754503 GACTTACAGTTCCATGTGGCTGG - Intronic
1092563940 12:9645378-9645400 GACTTACAGTTCCATGTGGCTGG - Intergenic
1093207213 12:16264852-16264874 GACTTACAGTTCCATGTGGCTGG - Intronic
1093239794 12:16656277-16656299 GACTTACAGTTCCATGTGGCTGG + Intergenic
1094295414 12:28899423-28899445 TACTTACAGTTCCATGTGGCTGG - Intergenic
1095610363 12:44120983-44121005 GACTTACAGTTCCATGTGGCTGG + Intronic
1095840183 12:46684349-46684371 GACTTACAGTTCCATGTGGCTGG + Intergenic
1096056868 12:48660417-48660439 CAAGTACAGATCCATGGGGCCGG + Exonic
1097668678 12:62511889-62511911 GACTTACAGTTCCATGTGGCTGG + Intronic
1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG + Intergenic
1098027433 12:66219475-66219497 GGCTTACAGTTCCATGTGGCTGG - Intronic
1098766950 12:74503236-74503258 GACTTACAGTTCCATGTGGCTGG + Intergenic
1099001529 12:77183409-77183431 GACTTACAGTTCCATGTGGCTGG + Intergenic
1099442322 12:82713465-82713487 GACTTACAGTTCCATGTGGCTGG + Intronic
1099501594 12:83420013-83420035 GACTTACAGTTCCATGTGGCTGG - Intergenic
1099655200 12:85480192-85480214 GACTTACAGTTCCATGTGGCTGG + Intergenic
1099766776 12:86997745-86997767 GACTTACAGTTCCATGTGGCTGG + Intergenic
1100118162 12:91335033-91335055 CACTTACAGTTCCACGTGGCTGG + Intergenic
1100782809 12:98047503-98047525 GGCTTACAGTTCCATGTGGCTGG + Intergenic
1100972863 12:100090057-100090079 TACTTACAGTTCCATGTGGCTGG - Intronic
1101427195 12:104598019-104598041 CCACAACAGTCCCATGGTGCGGG - Intronic
1104009257 12:124917552-124917574 CTCAGACAGTTTCATGGGGCTGG - Intergenic
1104391454 12:128394051-128394073 CACTCACAGTTCCATGAGGCTGG + Intronic
1105351285 13:19618318-19618340 GACTTACAGTTCCATGTGGCTGG - Intergenic
1106048328 13:26166241-26166263 GACTTACAGTTCCATGTGGCTGG - Intronic
1107578522 13:41754382-41754404 GACTTACAGTTCCATGTGGCTGG - Intronic
1108437534 13:50415395-50415417 GACTTACAGTTCCATGTGGCTGG + Intronic
1108719763 13:53118830-53118852 GACTTACAGTTCCATGTGGCTGG + Intergenic
1109169383 13:59076679-59076701 GACTTACAGTTCCATGTGGCTGG + Intergenic
1110018627 13:70440561-70440583 AACCCACAGTTCCATGTGGCTGG + Intergenic
1110044228 13:70809068-70809090 GACTTACAGTTTCATGGGGCTGG - Intergenic
1110500437 13:76221342-76221364 CCCCAACAGTTTCATGAGGTAGG - Intergenic
1110532077 13:76609580-76609602 GACTTACAGTTCCATGTGGCTGG + Intergenic
1111105578 13:83641922-83641944 GACTTACAGTTCCATGTGGCTGG + Intergenic
1111614951 13:90651463-90651485 GACTTACAGTTCCATGTGGCTGG - Intergenic
1111668423 13:91298951-91298973 GACTTACAGTTCCATGTGGCTGG - Intergenic
1111695066 13:91613233-91613255 GACTTACAGTTCCATGTGGCTGG + Intronic
1111943248 13:94636166-94636188 GACTTACAGTTCCATGTGGCTGG + Intergenic
1112008427 13:95274031-95274053 GACTTACAGTTCCATGTGGCTGG - Intronic
1113105108 13:106763343-106763365 GACTTACAGTTCCATGTGGCTGG - Intergenic
1113903970 13:113811037-113811059 CCTCCACAGCTGCATGGGGCAGG - Intronic
1114347992 14:21817321-21817343 GACTTACAGTTCCATGTGGCTGG + Intergenic
1114527725 14:23376999-23377021 CCCCTAGAGACCCATGGGGAGGG - Exonic
1114954730 14:27804121-27804143 ATCTTACAGTTCCATGTGGCTGG - Intergenic
1114989924 14:28273617-28273639 GACTTACAGTTCCATGTGGCTGG + Intergenic
1115016151 14:28616809-28616831 GACATACAGTTCCATGTGGCTGG + Intergenic
1115484219 14:33894093-33894115 GACTTACAGTTCCATGTGGCTGG - Intergenic
1115609317 14:35036310-35036332 GACTTACAGTTCCATGTGGCTGG + Intergenic
1116348553 14:43828719-43828741 GACTTACAGTTCCATGTGGCTGG - Intergenic
1116419962 14:44721477-44721499 GACTTACAGTTCCATGTGGCTGG - Intergenic
1116523021 14:45872290-45872312 AACTTACAGTTCCATGTGGCTGG + Intergenic
1116618067 14:47163587-47163609 GACTTACAGTTCCATGTGGCTGG - Intronic
1116664652 14:47759453-47759475 GACCTACAGTTCCATGTGGCTGG + Intergenic
1116745812 14:48817234-48817256 GACTTACAGTTCCATGTGGCTGG + Intergenic
1116831332 14:49722677-49722699 GACTTACAGTTCCATGTGGCTGG + Intronic
1118093740 14:62513119-62513141 GACTTACAGTTCCATGTGGCTGG + Intergenic
1118662632 14:68031133-68031155 GACTTACAGTTCCATGTGGCTGG + Intronic
1118835774 14:69476880-69476902 GACTTACAGTTCCATGCGGCTGG + Intergenic
1118836098 14:69479047-69479069 GACTTACAGTTCCATGTGGCTGG + Intergenic
1118956519 14:70488166-70488188 CCACTACAGTTGCCTGGGGCAGG - Intergenic
1120022471 14:79546116-79546138 GACTTACAGTTCCATGTGGCTGG - Intronic
1120337369 14:83174163-83174185 GACTTACAGTTCCATGTGGCTGG + Intergenic
1120614277 14:86683250-86683272 GATCTACAGTTCCATGTGGCTGG - Intergenic
1122158116 14:99763192-99763214 GACTTACAGTTCCATGTGGCTGG - Intronic
1122686657 14:103511447-103511469 CCCCCACAGGTCCTGGGGGCGGG - Intergenic
1122995507 14:105261789-105261811 CCTCTCCAGTCCCATGGGGCCGG - Intronic
1123773555 15:23554533-23554555 GACTTACAGTTCCATGTGGCTGG + Intergenic
1124358834 15:29019221-29019243 CCCCTCCTGTTCTGTGGGGCTGG + Intronic
1124691516 15:31827220-31827242 GACTTACAGTTCCATGTGGCTGG + Intronic
1125074067 15:35592113-35592135 GACTTACAGTTCCATGTGGCTGG + Intergenic
1125341714 15:38682228-38682250 GACTTACAGTTCCATGTGGCTGG + Intergenic
1125405374 15:39347572-39347594 CCCCTACAGTTACCTGGGAAGGG + Intergenic
1127101634 15:55571663-55571685 GACTTACAGTTCCATGTGGCTGG - Intronic
1127123857 15:55793570-55793592 CACTTACAGTTCCACGTGGCTGG - Intergenic
1127608953 15:60618348-60618370 CCCCTACAGATACATGTAGCAGG + Intronic
1128176924 15:65564483-65564505 GACTTACAGTTCCATGTGGCTGG + Intronic
1129900585 15:79145231-79145253 GGCTTACAGTTCCATGTGGCTGG + Intergenic
1130147661 15:81286837-81286859 GACTTACAGTTCCATGTGGCTGG + Intronic
1130762355 15:86833544-86833566 GACCTACAGTTCCATATGGCTGG - Intronic
1131449813 15:92529809-92529831 GACTTACAGTTCCATGTGGCTGG - Intergenic
1132194222 15:99898167-99898189 GACTTACAGTTCCATGTGGCTGG + Intergenic
1132517593 16:373081-373103 CACCCACTGTTCCATGGGGAGGG + Intronic
1132804221 16:1768299-1768321 CCCCTACTGCTCCATGGCCCAGG + Exonic
1133439084 16:5805649-5805671 CCCCTAGGGTTCCAGGGGGAAGG + Intergenic
1134447442 16:14341690-14341712 GACTTACAGTTCCATGTGGCTGG + Intergenic
1134475919 16:14573837-14573859 GACTTACAGTTCCATGTGGCTGG - Intronic
1137835110 16:51584227-51584249 CCCCTACAGTTCCTTGGTGAAGG + Intergenic
1138895588 16:61199740-61199762 GCCTTACAGTTCCATGTGTCTGG - Intergenic
1138908991 16:61373834-61373856 GACCTACAGTTCCACGTGGCTGG - Intergenic
1140511900 16:75514683-75514705 GACTTACAGTTCCATGCGGCTGG - Intergenic
1140850875 16:78933635-78933657 GACTTACAGTTCCATGTGGCTGG + Intronic
1141336756 16:83163187-83163209 GACTTACAGTTCCATGTGGCTGG - Intronic
1142029124 16:87829704-87829726 CCCCTGCAGCTCCCTGGGACTGG + Intergenic
1142278050 16:89133270-89133292 CTCCTCCACTCCCATGGGGCTGG - Intronic
1142994437 17:3752230-3752252 CCCCTCTAGTTCCATGGGCAGGG + Intronic
1143776749 17:9204588-9204610 CCCTTTCAGTTCCAAGGGGGTGG + Intronic
1144323279 17:14152247-14152269 CACCTACAGTTCCACATGGCTGG + Intronic
1146194974 17:30803773-30803795 AACTTACAGTTCCATGTGGCTGG - Intronic
1147740063 17:42666259-42666281 CCCCTGCAGGTCCAGGGCGCGGG - Intronic
1148640328 17:49182890-49182912 GACTTACAGTTCCATGTGGCTGG - Intergenic
1148789378 17:50164808-50164830 CCTCAGCAGTTCCATGAGGCAGG - Intronic
1148910750 17:50941259-50941281 CTTCTACAGTTCCCTAGGGCTGG + Intergenic
1151037389 17:70817228-70817250 GACTTACAGTTCCATGTGGCTGG - Intergenic
1151170162 17:72239006-72239028 GACTTACAGTTCCATGTGGCTGG - Intergenic
1151291100 17:73150732-73150754 GACTTACAGTTCCATGTGGCTGG + Intergenic
1151397957 17:73837090-73837112 GACTTACAGTTCCATGTGGCTGG - Intergenic
1152967251 18:128716-128738 GACTTACAGTTCCATGTGGCTGG + Intergenic
1153263047 18:3242445-3242467 GACTTACAGTTCCATGTGGCTGG - Intergenic
1153297497 18:3561856-3561878 GACTTACAGTTCCATGTGGCTGG + Intronic
1153577150 18:6533637-6533659 GACTTACAGTTCCATGTGGCTGG - Intronic
1153651108 18:7241100-7241122 GACTTACAGTTCCATGTGGCTGG + Intergenic
1154281185 18:13004793-13004815 CTCCTACAGCTCAATGTGGCTGG - Intronic
1154926734 18:20943339-20943361 GACTTACAGTTCCATGTGGCTGG - Intergenic
1155910027 18:31496409-31496431 CCCCTACAGATACATGGGGAAGG - Intergenic
1156593069 18:38513215-38513237 GACTTACAGTTCCATGTGGCTGG - Intergenic
1156858975 18:41814654-41814676 GACTTACAGTTCCATGTGGCTGG + Intergenic
1157319400 18:46622750-46622772 CCCCTACAATGCCATGTGGCTGG + Intronic
1158061352 18:53347707-53347729 GACTTACAGTTCCATGTGGCTGG + Intronic
1158061614 18:53349601-53349623 GACTTACAGTTCCATGTGGCTGG + Intronic
1158071333 18:53474653-53474675 GACTTACAGTTCCATGTGGCTGG - Intronic
1158150424 18:54361875-54361897 ACCCTACACTTCCATGGGCAAGG + Exonic
1158189038 18:54804488-54804510 GACTTACAGTTCCATGTGGCTGG - Intronic
1158930727 18:62323627-62323649 GACTTACAGTTCCATGTGGCTGG - Intergenic
1159113728 18:64089701-64089723 GACTTACAGTTCCATGTGGCTGG + Intergenic
1159846389 18:73465810-73465832 ACCTTACAGTTCCATATGGCTGG - Intergenic
1160122198 18:76140606-76140628 ACCCAACAGTTCTATGTGGCTGG - Intergenic
1160311376 18:77794018-77794040 GACTTACAGTTCCATGTGGCTGG - Intergenic
1160518461 18:79490975-79490997 CCCCCGCATTTCCATGGAGCTGG - Intronic
1162031659 19:7920209-7920231 CCCCTTCACTTCCATTGGGGCGG + Intergenic
1163417482 19:17195347-17195369 CCGCCACAGTTCCACGGCGCTGG - Exonic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1163763659 19:19150586-19150608 CCCCTGCAGTTCAATTGGTCAGG + Intronic
1164393909 19:27847510-27847532 CCCTTACAGATACATGGGGAAGG + Intergenic
1164414184 19:28032565-28032587 AACTTACAGTTCCATGTGGCTGG + Intergenic
1164447533 19:28330759-28330781 GACTTACAGTTCCATGTGGCTGG - Intergenic
1164892871 19:31839914-31839936 GACTCACAGTTCCATGGGGCTGG + Intergenic
1165737180 19:38184139-38184161 CCACAACAGCTCCATGGGGGTGG + Intronic
1166777743 19:45323034-45323056 CCCATACAAGGCCATGGGGCTGG - Intergenic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1167679616 19:50911262-50911284 TCCCTACAGCTCCATGTCGCTGG - Intergenic
1168372635 19:55849000-55849022 GACCCACAGTTCCATGTGGCTGG - Intronic
925206595 2:2012691-2012713 GCCCTCCAGTTCCATCTGGCTGG + Intronic
925301957 2:2823249-2823271 CCCCTGCAGAGCCATGGGGTGGG - Intergenic
925412970 2:3650579-3650601 CCCCCACAGAACTATGGGGCAGG - Intergenic
925724593 2:6860611-6860633 GACTTACAGTTCCATGGGGCTGG - Intronic
927030686 2:19117873-19117895 GACTTACAGTTCCATGTGGCTGG + Intergenic
927341090 2:21983665-21983687 GACTTACAGTTCCATGTGGCTGG + Intergenic
927380569 2:22475354-22475376 GACTTACAGTTCCATGTGGCTGG - Intergenic
929811459 2:45192574-45192596 AACTTACAGTTCCATGTGGCTGG + Intergenic
930774545 2:55159279-55159301 CCCCTCCACTTCCACTGGGCAGG + Intergenic
931407212 2:61990594-61990616 GACTTACAGTTCCATGTGGCCGG + Intronic
932878574 2:75477971-75477993 GACTTACAGTTCCATGTGGCTGG - Intronic
932927027 2:75988756-75988778 GACTTACAGTTCCATGTGGCTGG + Intergenic
933009784 2:77045725-77045747 GACTTACAGTTCCATGTGGCTGG - Intronic
934054866 2:88243081-88243103 GACCTACAGTTCCACGTGGCTGG - Intergenic
934055136 2:88244978-88245000 GACTTACAGTTCCATGTGGCTGG - Intergenic
934112893 2:88758797-88758819 GACTTACAGTTCCATGTGGCTGG - Intergenic
934482586 2:94665159-94665181 ATCTTACAGTTCCATGTGGCTGG + Intergenic
935419547 2:102853334-102853356 GACTTACAGTTCCATGTGGCTGG + Intergenic
935445501 2:103151997-103152019 GACTTACAGTTCCATGTGGCTGG - Intergenic
936096877 2:109536956-109536978 GGCTTACAGTTCCATGTGGCTGG - Intergenic
937008808 2:118543209-118543231 GACTTACAGTTCCATGTGGCTGG - Intergenic
937620488 2:123979739-123979761 GACTTACAGTTCCATGTGGCTGG - Intergenic
937620702 2:123981379-123981401 GACTTACAGTTCCATGTGGCTGG - Intergenic
937646828 2:124274963-124274985 GACCTACAGTTCCATATGGCTGG + Intronic
938992312 2:136642109-136642131 GACTTACAGTTCCATGTGGCTGG + Intergenic
939201799 2:139044805-139044827 GACTTACAGTTCCATGTGGCTGG - Intergenic
939694790 2:145311269-145311291 GACTTACAGTTCCATGTGGCTGG + Intergenic
939847907 2:147269860-147269882 GACTTACAGTTCCATGTGGCTGG + Intergenic
940408673 2:153335131-153335153 GACTTACAGTTCCATGTGGCTGG - Intergenic
941124439 2:161568834-161568856 ACCTTTCAGCTCCATGGGGCTGG - Intronic
941423911 2:165319583-165319605 GACTTACAGTTCCATGTGGCTGG + Intronic
941424177 2:165321538-165321560 GACTTACAGTTCCATGTGGCTGG + Intronic
942053482 2:172162390-172162412 CCCCCTCTGGTCCATGGGGCTGG + Intergenic
942281223 2:174365555-174365577 GACTTACAGTTCCATGTGGCTGG + Intronic
942319447 2:174723910-174723932 GACTTACAGTTCCATGTGGCTGG + Intergenic
942366934 2:175238243-175238265 GACTTACAGTTCCATGTGGCTGG + Intergenic
942601216 2:177643020-177643042 GACTTACAGTTCCATGCGGCTGG - Intronic
942727406 2:179025533-179025555 GACTTACAGTTCCATGTGGCTGG - Intronic
943245840 2:185450369-185450391 GACTTACAGTTCCATGTGGCTGG + Intergenic
943478300 2:188386143-188386165 GACTTACAGTTCCATGTGGCTGG + Intronic
943543413 2:189244881-189244903 GACTTACAGTTCCATGTGGCTGG + Intergenic
943848810 2:192689155-192689177 GACTTACAGTTCCATGAGGCTGG - Intergenic
943859544 2:192843595-192843617 CACTCACAGTTCCATGTGGCTGG + Intergenic
944024278 2:195144544-195144566 GACTTACAGTTCCATGTGGCTGG - Intergenic
944467566 2:200018482-200018504 GACTTACAGTTCCATGTGGCTGG + Intergenic
944661917 2:201928602-201928624 CCCCAACCCTTCCATGGAGCAGG + Intergenic
945324823 2:208470615-208470637 GACTTACAGTTCCATGCGGCTGG - Intronic
945480193 2:210336403-210336425 GACCTACAGTTCCACGTGGCTGG - Intergenic
946063237 2:216963446-216963468 GACTTACAGTTCCATGTGGCTGG - Intergenic
946562589 2:220929236-220929258 AACTTACAGTTCCATGTGGCTGG + Intergenic
946906864 2:224425872-224425894 GACTTACAGTTCCATGCGGCTGG - Intergenic
947457895 2:230272609-230272631 GACTTACAGTTCCATGTGGCTGG - Intronic
1169968087 20:11239171-11239193 GACTTACAGTTCCATGTGGCTGG - Intergenic
1170079156 20:12451756-12451778 GACCTACAGTTCCACGTGGCTGG - Intergenic
1170566785 20:17612116-17612138 TACCTTCACTTCCATGGGGCAGG + Intergenic
1170751787 20:19154924-19154946 ACCTCACAGTTCCATGTGGCTGG + Intergenic
1171118822 20:22550505-22550527 GACTTACATTTCCATGGGGCTGG + Intergenic
1171451304 20:25237817-25237839 CCCCTCCAGTTGCATGCAGCGGG + Intergenic
1172487263 20:35305804-35305826 CCCCTTCAGCTCCAGGGGCCAGG + Intronic
1173098413 20:40060650-40060672 GACTTACAGTTCCATGTGGCTGG - Intergenic
1174701404 20:52612712-52612734 GACTTACAGTTCCATGTGGCTGG - Intergenic
1175068625 20:56312409-56312431 GACTTACAGTTCCATGTGGCTGG - Intergenic
1176092043 20:63322450-63322472 GCCCTTGATTTCCATGGGGCAGG + Intronic
1176114260 20:63424279-63424301 CCCCCACAGTCCCATGGGTCAGG + Intronic
1177392758 21:20498188-20498210 CACTTACAGTTCCATGTGGCTGG + Intergenic
1177438839 21:21091545-21091567 GACTTACAGTTCCATGTGGCTGG + Intronic
1177557898 21:22715463-22715485 GACTTACAGTTCCATGTGGCTGG + Intergenic
1177742074 21:25166998-25167020 ACTCAACAGTTCCATGTGGCTGG - Intergenic
1177755499 21:25342311-25342333 CACTCACAGTTCCATGTGGCTGG - Intergenic
1177839155 21:26217338-26217360 AACTTACAGTTCCATGTGGCTGG - Intergenic
1177847036 21:26301532-26301554 GACTTACAGTTCCATGTGGCTGG - Intergenic
1178052870 21:28767222-28767244 TACGTACAGTTCCATGTGGCTGG - Intergenic
1178221715 21:30668261-30668283 TACTTACAGTTCCATGTGGCTGG - Intergenic
1178384740 21:32139926-32139948 GACTTACAGTTCCATGTGGCTGG - Intergenic
1178522942 21:33301626-33301648 CCCCATCAGCTCCATAGGGCAGG - Intergenic
1179310335 21:40189804-40189826 GACTTACAGTTCCATGTGGCTGG - Intronic
1180848386 22:18997205-18997227 CCCCTACAGTTCCATGGGGCAGG - Intergenic
1182935845 22:34220875-34220897 GACTTACAGTTCCATGTGGCTGG - Intergenic
1184483444 22:44761783-44761805 GACTTACAGTTCCATGTGGCTGG + Intronic
1184874520 22:47265244-47265266 GACTTACAGTTCCATGTGGCTGG + Intergenic
949369279 3:3317444-3317466 GACTTACAGTTCCATGTGGCTGG + Intergenic
949881478 3:8664307-8664329 CTGCCACAGATCCATGGGGCAGG + Intronic
950146173 3:10651508-10651530 GACTTACAGTTCCATGTGGCTGG - Intronic
951324715 3:21287545-21287567 GACTTACAGTTCCATGTGGCTGG - Intergenic
951446001 3:22781657-22781679 GACTTACAGTTCCATGTGGCTGG + Intergenic
952163718 3:30722717-30722739 CCCTTATAGTTCCATGGGGTTGG - Intergenic
953898168 3:46820160-46820182 GACTTACAGTTCCATGTGGCTGG - Intergenic
954475275 3:50738344-50738366 GGCCCACAGTTTCATGGGGCAGG + Intronic
955682738 3:61519187-61519209 GACTTACAGTTCCATGTGGCTGG + Intergenic
955701195 3:61683978-61684000 GCCCTACGGTACCATGGAGCTGG - Intronic
955820435 3:62890749-62890771 GACTTACAGTTCCATGTGGCTGG + Intergenic
956360687 3:68443518-68443540 GACTTACAGTTCCATGTGGCTGG + Intronic
957396381 3:79644421-79644443 TACTTACAGTTCCATGTGGCTGG + Intronic
957403551 3:79748829-79748851 GACTTACAGTTCCATGTGGCTGG - Intronic
957646404 3:82935857-82935879 GACCCACAGTTCCATGTGGCCGG + Intergenic
957840964 3:85668697-85668719 GACTTACAGTTCCATAGGGCTGG - Intronic
958638811 3:96778906-96778928 GACTTACAGTTCCATGTGGCTGG - Intergenic
958763742 3:98340179-98340201 GACTTACAGTTCCATGTGGCTGG - Intergenic
959054608 3:101554754-101554776 GGCTTACAGTTCCATGTGGCTGG - Intergenic
959624173 3:108431537-108431559 GACTTACAGTTCCATGTGGCTGG - Intronic
959801932 3:110505201-110505223 GACTTACAGTTCCATGTGGCTGG - Intergenic
960866750 3:122209423-122209445 GACTTACAGTTCCATGTGGCTGG + Intronic
961862797 3:129930931-129930953 GGCTTACAGTTCCATGTGGCTGG + Intergenic
962589471 3:136873865-136873887 GACTTACAGTTCCATGTGGCTGG - Intronic
962689257 3:137877337-137877359 GCTGTACAGTTCCATGTGGCTGG - Intergenic
962770222 3:138604502-138604524 CACTTACAGTTCCATATGGCTGG - Intergenic
962951807 3:140226742-140226764 GACTTACAGTTCCATGTGGCTGG + Intronic
962960517 3:140307172-140307194 GGCTTACAGTTCCATGTGGCTGG - Intronic
963011506 3:140774885-140774907 GACTTACAGTTCCATGTGGCTGG + Intergenic
963150042 3:142035853-142035875 GACTTACAGTTCCATGTGGCTGG - Intronic
963339614 3:144019164-144019186 GACTTACAGTTCCATGTGGCTGG + Intronic
963345626 3:144093586-144093608 GACTTACAGTTCCATGTGGCTGG - Intergenic
963532281 3:146485784-146485806 GACTTACAGTTCCATGTGGCTGG + Intronic
963985417 3:151587917-151587939 GACTTACAGTTCCATGTGGCTGG - Intergenic
965446113 3:168776569-168776591 GACTTACAGTTCCATGTGGCTGG - Intergenic
966411525 3:179650738-179650760 GACTTACAGTTCCATGTGGCTGG + Intergenic
966415290 3:179683464-179683486 GACTTACAGTTCCATGTGGCTGG + Intronic
966929137 3:184664342-184664364 CCCCAACAAGCCCATGGGGCAGG + Intronic
967521157 3:190434494-190434516 GACTTACAGTTCCATGTGGCTGG - Intronic
968006801 3:195248591-195248613 GACTTACAGTTCCATGTGGCTGG - Intronic
968417727 4:454638-454660 CCCTTACAGATACATGGGGAAGG - Intronic
969241368 4:5900628-5900650 CTCCAACCGTGCCATGGGGCAGG - Intronic
969616851 4:8258242-8258264 GACTTACAGTTCCATGTGGCTGG - Intergenic
970127486 4:12831349-12831371 GACTTACAGTTCCATGTGGCTGG + Intergenic
970598617 4:17622764-17622786 GACTTACAGTTCCATGTGGCTGG + Intronic
970635326 4:18004344-18004366 GACTTACAGTTCCATGTGGCTGG + Intronic
970674553 4:18433692-18433714 GACTTACAGTTCCATGTGGCTGG - Intergenic
971510325 4:27416244-27416266 GACTTACAGTTCCATGTGGCTGG - Intergenic
972011057 4:34182778-34182800 GACCCACAGTTCCATGTGGCTGG + Intergenic
972100512 4:35408665-35408687 CATTTACAGTTCCATGTGGCTGG - Intergenic
972291606 4:37695026-37695048 GACTTACAGTTCCATGTGGCTGG + Intergenic
972744783 4:41922405-41922427 GACCCACAGTTCCATAGGGCTGG - Intergenic
972749536 4:41974233-41974255 GACTTACAGTTCCATGTGGCTGG - Intergenic
972913513 4:43847891-43847913 GACATACAGTTCCATGTGGCTGG + Intergenic
973294901 4:48507666-48507688 GCCCTACAGTTTCACTGGGCTGG + Intronic
973796067 4:54427897-54427919 TCCCTAAAGTTCCATGGGGGTGG - Intergenic
973975218 4:56256363-56256385 GGACTACAGTTCCATGGGGCTGG - Intronic
973995302 4:56452671-56452693 CCCCCACAGTTACAGGAGGCGGG + Intronic
974106631 4:57477268-57477290 GACTTACAGTTCCATGTGGCTGG + Intergenic
974139248 4:57863335-57863357 GACTTACAGTTCCATGTGGCTGG - Intergenic
974679728 4:65145959-65145981 GACTTACAGTTCCATGTGGCTGG + Intergenic
974802889 4:66841457-66841479 AACGTACAGTTCCATGTGGCTGG - Intergenic
974897735 4:67959005-67959027 CACTCACAGTTCCATGTGGCTGG - Intronic
975110649 4:70619194-70619216 GACTTACAGTTCCATGAGGCTGG - Intergenic
975200361 4:71581250-71581272 GACTTACAGTTCCATGTGGCTGG + Intergenic
975876033 4:78838052-78838074 GACTTACAGTTCCATGTGGCTGG + Intronic
976056976 4:81080509-81080531 TACTTACAGTTCCATGTGGCTGG - Intergenic
976259731 4:83134528-83134550 GACTTACAGTTCCATGTGGCTGG + Intronic
976440511 4:85068208-85068230 GACTTACAGTTCCATGTGGCTGG + Intergenic
976472017 4:85440004-85440026 GACTTACAGTTCCATGTGGCTGG + Intergenic
976635541 4:87283411-87283433 GACTTACAGTTCCATGTGGCTGG - Intergenic
976939717 4:90684928-90684950 GACTTACAGTTCCATGTGGCTGG - Intronic
977014821 4:91678970-91678992 GACTTACAGTTCCATGTGGCTGG - Intergenic
977093752 4:92713629-92713651 GACCTACAGCTCCATGTGGCTGG + Intronic
977189279 4:93978866-93978888 GACTTACAGTTCCATGTGGCTGG - Intergenic
977339739 4:95743478-95743500 AACTTACAGTTCCATGTGGCTGG - Intergenic
977973210 4:103234128-103234150 GACTTACAGTTCCATGTGGCTGG - Intergenic
978105637 4:104898854-104898876 GACTTACAGTTCCATGTGGCTGG + Intergenic
978451022 4:108833997-108834019 CCCCTACAATTCCATGAGAGCGG - Intronic
979132292 4:117062414-117062436 GACTTACAGTTCCATGTGGCTGG - Intergenic
979500348 4:121433465-121433487 GACTTACAGTTCCATGTGGCTGG + Intergenic
980299291 4:130966303-130966325 GACATACAGTTCCATGTGGCTGG - Intergenic
980553079 4:134365811-134365833 GACTTACAGTTCCACGGGGCTGG - Intergenic
980850261 4:138373301-138373323 CCACATCAGTTCCATGTGGCTGG + Intergenic
980946141 4:139322364-139322386 GACTTACAGTTCCATGAGGCTGG - Intronic
984234611 4:177141331-177141353 GACTTACAGTTCCATGTGGCTGG - Intergenic
984616582 4:181905030-181905052 GACTTACAGTTCCATGTGGCTGG - Intergenic
985094859 4:186403284-186403306 GACTTACAGTTCCATGTGGCTGG + Intergenic
985201299 4:187487922-187487944 GACTTACAGTTCCATGCGGCTGG - Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986348207 5:6853836-6853858 GACTTACAGTTCCATGTGGCTGG - Intergenic
986531671 5:8743062-8743084 GACTTACAGTTCCATGTGGCTGG - Intergenic
986680214 5:10225532-10225554 GACTTACAGTTCCATGTGGCTGG + Intergenic
986697512 5:10371417-10371439 GACTTACAGTTCCATGTGGCTGG + Intronic
987025805 5:13925491-13925513 GCCTTACAGTTCCACGTGGCTGG + Intronic
987180938 5:15367879-15367901 TCCTCACAGTTCCATGTGGCTGG - Intergenic
987247168 5:16060597-16060619 GACTTACAGTTCCATGTGGCTGG + Intergenic
987620919 5:20337883-20337905 CACTTACAGTTCCACGTGGCTGG + Intronic
987773746 5:22337650-22337672 GACTTACAGTTCCATGTGGCTGG - Intronic
988025371 5:25679778-25679800 CTCTCACAGTTCCATGTGGCTGG - Intergenic
988098816 5:26652842-26652864 GACTTACAGTTCCATGTGGCTGG - Intergenic
988150101 5:27365691-27365713 GACTTACAGTTCCATGTGGCTGG - Intergenic
988865633 5:35331352-35331374 GACTTACAGTTCCATGTGGCCGG - Intergenic
988965586 5:36414305-36414327 GACTTACAGTTCCATGTGGCTGG + Intergenic
989001985 5:36770831-36770853 GACTTACAGTTCCATGTGGCTGG + Intergenic
989514394 5:42325087-42325109 GACTTACAGTTCCATGTGGCTGG + Intergenic
989992421 5:50782928-50782950 TCACTACAGTCCCTTGGGGCTGG + Intronic
990298130 5:54424012-54424034 CCCCTACTCTTACATGGGGTGGG - Intergenic
990716840 5:58646755-58646777 ACCCTAGAGATGCATGGGGCCGG - Intronic
991406624 5:66306310-66306332 CTCCTCCAGGTCAATGGGGCAGG + Intergenic
992412333 5:76518281-76518303 GACTTACAGTTCCATGTGGCTGG + Intronic
993024044 5:82625846-82625868 GACTTACAGTTCCATGTGGCTGG - Intergenic
993293968 5:86110127-86110149 GACTTACAGTTCCATGTGGCTGG - Intergenic
993753496 5:91700042-91700064 GACTTACAGTTCCATGTGGCTGG + Intergenic
993866260 5:93200139-93200161 CCCAGAGAGTCCCATGGGGCTGG - Intergenic
994041048 5:95260119-95260141 CCCTTACAGATACATGGGGAAGG - Intronic
994655785 5:102592113-102592135 GACTTACAGTTCCATGTGGCTGG + Intergenic
994755740 5:103791396-103791418 GACTTACAGTTCCATGTGGCTGG + Intergenic
995113676 5:108454950-108454972 AACTTACAGTTCCATGTGGCTGG - Intergenic
995597893 5:113766891-113766913 GACTTACAGTTCCATGTGGCTGG - Intergenic
996268248 5:121569696-121569718 GACTTACAGTTCCATGTGGCTGG - Intergenic
996352241 5:122557580-122557602 GACTTACAGTTCCATGTGGCTGG + Intergenic
996424506 5:123299339-123299361 ACCCTACAGTGCTATGGTGCCGG - Intergenic
996621345 5:125507429-125507451 GACTTACAGTTCCATGTGGCTGG + Intergenic
997367809 5:133336925-133336947 CCTCTCCAGATCCATGGGGATGG + Intronic
997652159 5:135530500-135530522 GACTTACAGTTCCATGTGGCTGG + Intergenic
998295558 5:140966481-140966503 CCGCTACAGCTCCAGGGGGAGGG - Exonic
998695502 5:144633518-144633540 AACCTACAGTTCCACGTGGCTGG - Intergenic
999641661 5:153678901-153678923 CCCCTTCATTTTCATGGGGAAGG - Intronic
1000522719 5:162318038-162318060 AACTTACAGTTCCATGTGGCTGG - Intergenic
1000522973 5:162319963-162319985 GACTTACAGTTCCATGTGGCTGG - Intergenic
1000761795 5:165234511-165234533 GACTTACAGTTCCATGTGGCTGG - Intergenic
1000954960 5:167532405-167532427 GACTTACAGTTCCATGTGGCTGG + Intronic
1001574577 5:172754759-172754781 CCTCCTAAGTTCCATGGGGCTGG + Intergenic
1004191987 6:13471974-13471996 GACTTACAGTTCCATGTGGCTGG + Intronic
1004609336 6:17224491-17224513 GACTTACAGTTCCATGTGGCTGG + Intergenic
1004951206 6:20673821-20673843 GACTTACAGTTCCATGTGGCTGG - Intronic
1005257009 6:24014036-24014058 CCCTTACAGTTCCATGTGGCTGG - Intergenic
1006256137 6:32833981-32834003 GACTTACAGTTCCATGTGGCTGG - Intronic
1006358662 6:33575428-33575450 CTCCTACAGCACCATGGGGCAGG - Exonic
1008244937 6:49160578-49160600 CTCTTACAGTTCCATATGGCTGG + Intergenic
1009396105 6:63202826-63202848 TACTTACAGTTCCATGTGGCTGG + Intergenic
1009396378 6:63204794-63204816 GGCTTACAGTTCCATGTGGCTGG + Intergenic
1009577381 6:65483768-65483790 GACCTACAGTTCCACGTGGCTGG + Intronic
1009826908 6:68878790-68878812 GACTTACAGTTCCATGTGGCTGG + Intronic
1010282483 6:74037570-74037592 AACTTACAGTTCCATGTGGCTGG - Intergenic
1010459213 6:76094640-76094662 GACTTACAGTTCCATGTGGCTGG - Intergenic
1010549403 6:77202177-77202199 GACTTACAGTTCCATGTGGCTGG - Intergenic
1010655766 6:78508728-78508750 GACTTACAGTTCCATGTGGCTGG - Intergenic
1010713778 6:79205542-79205564 GACTTACAGTTCCATGTGGCTGG - Intronic
1010735709 6:79442158-79442180 GACTTACAGTTCCATGTGGCTGG + Intergenic
1010920225 6:81672218-81672240 GACTTACAGTTCCATGTGGCTGG + Intronic
1011148097 6:84240956-84240978 GACTTACAGTTCCATGTGGCTGG - Intergenic
1011383558 6:86768828-86768850 CAAGTACAGATCCATGGGGCTGG + Intergenic
1012005556 6:93708712-93708734 GACTTACAGTTCCATGTGGCTGG - Intergenic
1012240112 6:96861304-96861326 CACTCACAGTTCCATGTGGCTGG - Intergenic
1013783823 6:113757237-113757259 CACTTACAGTTCCATGTGGCTGG - Intergenic
1014029353 6:116682592-116682614 AGCCTTCATTTCCATGGGGCTGG - Intronic
1014980633 6:127942590-127942612 GACTTACAGTTCCATGTGGCTGG + Intergenic
1015130355 6:129802528-129802550 GACTTACAGTTCCATGTGGCTGG - Intergenic
1016106442 6:140170294-140170316 GACTTACAGTTCCATGTGGCTGG + Intergenic
1016122633 6:140363207-140363229 GACTTACAGTTCCATGTGGCTGG - Intergenic
1016177724 6:141100226-141100248 GACTTACAGTTCCATGTGGCTGG - Intergenic
1016208835 6:141504447-141504469 GACTTACAGTTCCATGTGGCTGG + Intergenic
1016281884 6:142427710-142427732 CACTTACAGTTCCATGTGACTGG + Intronic
1016424322 6:143917253-143917275 GACTTACAGTTCCATGTGGCTGG - Intronic
1016471738 6:144381767-144381789 GACTTACAGTTCCATGTGGCTGG - Intronic
1016477211 6:144440812-144440834 GACTTACAGTTCCATGTGGCTGG + Intronic
1016579589 6:145615372-145615394 GACTTACAGTTCCATGTGGCTGG - Intronic
1016579869 6:145617312-145617334 GACTTACAGTTCCATGTGGCTGG - Intronic
1016862359 6:148733592-148733614 GACTTACAGTTCCATGTGGCTGG + Intergenic
1017062764 6:150500839-150500861 GACTTACAGTTCCATGTGGCTGG - Intergenic
1017580613 6:155860281-155860303 GACCTCCAGTTCCATGTGGCTGG - Intergenic
1017979965 6:159392816-159392838 GACTTACAGTTCCATGTGGCTGG + Intergenic
1018271415 6:162082310-162082332 CACTTACAGTTCCACGTGGCTGG - Intronic
1018578947 6:165290881-165290903 GACTTACAGTTCCATGTGGCTGG + Intronic
1019143268 6:169961599-169961621 CCCGGAAAGTTCCATGGGACAGG - Intergenic
1019543180 7:1560555-1560577 CCCCTGCACTTCAATGGGGTGGG - Intronic
1020227834 7:6294123-6294145 GACTTACAGTTCCATGTGGCTGG - Intergenic
1020730119 7:11869639-11869661 GGACTACAGTTCCATGTGGCTGG + Intergenic
1021074135 7:16279904-16279926 GACTTACAGTTCCATGTGGCTGG + Intronic
1021529943 7:21632960-21632982 GACATACAGTTCCATGTGGCTGG + Intronic
1021864279 7:24939471-24939493 TCCCTAGAGTTCCATTGGCCAGG - Intronic
1022306884 7:29154908-29154930 TACTTACAGTTCCATGTGGCTGG + Intronic
1022810165 7:33860690-33860712 GACTTACAGTTCCATGTGGCTGG - Intergenic
1023231721 7:38038946-38038968 GACTTACAGTTCCATGTGGCTGG + Intergenic
1023505559 7:40896680-40896702 AACTCACAGTTCCATGGGGCTGG - Intergenic
1023565066 7:41515936-41515958 GTCTTACAGTTCCATGTGGCTGG - Intergenic
1023786765 7:43716036-43716058 GACTTACAGTTCCATGTGGCTGG - Intronic
1024792667 7:52984569-52984591 GACTTACAGTTCCATGTGGCTGG - Intergenic
1025261779 7:57425004-57425026 CCGCTCCGGTTCCACGGGGCAGG - Intergenic
1025977418 7:66379821-66379843 TCCTTACAGTTCCATGGCTCTGG + Intronic
1026181794 7:68048078-68048100 GACTTACAGTTCCATGTGGCTGG - Intergenic
1026330792 7:69350976-69350998 GACTCACAGTTCCATGGGGCTGG + Intergenic
1026671160 7:72391794-72391816 GACCCACAGTTCCATGTGGCTGG - Intronic
1027625916 7:80544774-80544796 AACTTACAGTTCCATGTGGCTGG - Intronic
1028063793 7:86355609-86355631 GACTTACAGTTCCATGTGGCTGG + Intergenic
1028790042 7:94843634-94843656 GGCTTACAGTTCCATGTGGCTGG - Intergenic
1028795274 7:94895309-94895331 GACTTACAGTTCCATGTGGCTGG + Intergenic
1028817770 7:95167089-95167111 AACTTACAGTTCCATGTGGCTGG + Intronic
1029036934 7:97532420-97532442 GCCTTACAGTTCCACGTGGCTGG + Intergenic
1029600426 7:101560050-101560072 GACTTACAGTTCCATGTGGCTGG + Intergenic
1030415641 7:109239252-109239274 GACTCACAGTTCCATGGGGCTGG - Intergenic
1030459197 7:109809069-109809091 AACTTACAGTTCCATGTGGCTGG - Intergenic
1030915735 7:115310370-115310392 GACTTACAGTTCCATGTGGCTGG + Intergenic
1031290383 7:119927508-119927530 GACTTACAGTTCCATGTGGCTGG - Intergenic
1031290510 7:119928526-119928548 GACTTACAGTTCCATGTGGCTGG - Intergenic
1031567963 7:123322650-123322672 GACTTACAGTTCCATGTGGCTGG - Intergenic
1031723686 7:125209173-125209195 GACTTACAGTTCCATGTGGCTGG - Intergenic
1031778355 7:125930826-125930848 GACTTACAGTTCCATGTGGCTGG + Intergenic
1031807783 7:126328390-126328412 GACTTACAGTTCCATGTGGCTGG - Intergenic
1032013339 7:128360670-128360692 CCCCTCCCGTTTCCTGGGGCTGG + Intronic
1032731091 7:134643769-134643791 GACTTACAGTTCCATGTGGCTGG - Intergenic
1032802980 7:135331260-135331282 GACTTACAGTTCCATGTGGCTGG - Intergenic
1033730116 7:144170340-144170362 GACTTACAGTTCCATGTGGCTGG - Intergenic
1033823599 7:145162736-145162758 GCCTTACCGTTCCATGTGGCTGG - Intergenic
1034198049 7:149262714-149262736 CCGCTACTGTCCCGTGGGGCTGG - Intronic
1034387084 7:150748980-150749002 CCCCTACGTTTCCATGGTGATGG + Intronic
1034646623 7:152653284-152653306 GACTTACAGTTCCATGTGGCTGG - Intronic
1034748381 7:153544616-153544638 GACTTACAGTTCCATGTGGCTGG + Intergenic
1034852067 7:154502609-154502631 GACTTACAGTTCCATGTGGCTGG - Intronic
1035321806 7:158034561-158034583 GACTTACAGTTCCATGTGGCTGG - Intronic
1035348141 7:158221543-158221565 GACCCACAGTTCCATGTGGCTGG + Intronic
1036183758 8:6606936-6606958 GACTTACAGTTCCATGTGGCTGG - Intronic
1037494795 8:19428297-19428319 GCCTCACAGTTCCATGTGGCTGG + Intronic
1037628716 8:20632613-20632635 GACTTACAGTTCCATGTGGCTGG + Intergenic
1037735169 8:21560133-21560155 CCACTGCAGATCCATTGGGCAGG - Intergenic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1039585656 8:38704936-38704958 CTCCTGCAGTCCCAAGGGGCAGG + Intergenic
1041186497 8:55306475-55306497 GACTTACAGTTCCATGTGGCTGG + Intronic
1041351502 8:56952057-56952079 GACTTACAGTTCCATGTGGCTGG + Intergenic
1041472073 8:58221922-58221944 CCCCTACAGATCCATCAGGAGGG - Intergenic
1041551055 8:59102101-59102123 GACTTACAGTTCCATGTGGCTGG + Intronic
1042489919 8:69385397-69385419 GACTCACAGTTCCATGGGGCTGG - Intergenic
1042923341 8:73941222-73941244 GACTTACAGTTCCATGTGGCTGG - Intronic
1044031248 8:87240793-87240815 CTCCTGCAGTTCCCTGGAGCTGG + Intronic
1044365673 8:91342365-91342387 CCACCACAGCTCTATGGGGCAGG + Intronic
1044760836 8:95515459-95515481 AACTTACAGTTCCATGTGGCTGG + Intergenic
1045137509 8:99237136-99237158 GACTTACAGTTCCATGTGGCTGG - Intronic
1045603951 8:103751107-103751129 GACTTACAGTTCCATGTGGCTGG - Intronic
1045715825 8:105044092-105044114 GACTTACAGTTCCATGTGGCTGG + Intronic
1046617953 8:116498650-116498672 AACTTACAGTTCCATGTGGCTGG + Intergenic
1046694309 8:117321597-117321619 GACTTACAGTTCCATGTGGCTGG + Intergenic
1047534966 8:125711346-125711368 GACTTACAGTTCCATGTGGCTGG - Intergenic
1047942513 8:129839121-129839143 GACTTACAGTTCCATGTGGCTGG - Intergenic
1048083846 8:131156812-131156834 GACTTACAGTTCCATGTGGCTGG - Intergenic
1048122060 8:131592618-131592640 GACTTACAGTTCCATGGGGCTGG - Intergenic
1048768420 8:137868741-137868763 CACTTACAGTTCCATGTGGCTGG - Intergenic
1048783149 8:138023051-138023073 GACTTACAGTTCCATGCGGCTGG + Intergenic
1048864439 8:138749173-138749195 GACTCACAGTTCCATGGGGCTGG - Intronic
1049016583 8:139924363-139924385 TCCCTTCAGCTCCATGTGGCCGG - Intronic
1049522317 8:143099740-143099762 TACTTACAGTTCCATGTGGCTGG + Intergenic
1049657268 8:143804421-143804443 CCCCTGCAGCTCCTTGAGGCTGG - Intronic
1049848733 8:144819477-144819499 CCCCAACAGTGGCCTGGGGCAGG - Intergenic
1051217054 9:14809243-14809265 GACTTACAGTTCCATGTGGCTGG - Intronic
1051326815 9:15980916-15980938 AACCTACAGTTCCATGTGGTTGG + Intronic
1051451916 9:17206596-17206618 CCCTTACAGATACATGGGGAAGG - Intronic
1051573318 9:18584374-18584396 GACTTACAGTTCCATGTGGCTGG - Intronic
1051583417 9:18701973-18701995 GACTTACAGTTCCATGTGGCTGG + Intronic
1051644292 9:19252116-19252138 GACTTACAGTTCCATGTGGCTGG + Intronic
1051743483 9:20273657-20273679 GACTTACAGTTCCATGTGGCTGG - Intergenic
1051795192 9:20860368-20860390 GACTTACAGTTCCATGTGGCTGG + Intronic
1052024377 9:23558460-23558482 AACTTACAGTTCCATGTGGCTGG + Intergenic
1052169291 9:25374252-25374274 GACTTACAGTTCCATGTGGCTGG + Intergenic
1052311741 9:27075539-27075561 GACTTACAGTTCCATGTGGCTGG - Intergenic
1052733480 9:32316511-32316533 GACTTACAGTTCCATGTGGCTGG + Intergenic
1053460081 9:38261894-38261916 GACTTACAGTTCCATGTGGCTGG + Intergenic
1053675255 9:40419582-40419604 ATCTTACAGTTCCATGTGGCTGG - Intergenic
1053925040 9:43045917-43045939 ATCTTACAGTTCCATGTGGCTGG - Intergenic
1054288528 9:63258108-63258130 ATCTTACAGTTCCATGTGGCTGG - Intergenic
1054386355 9:64559645-64559667 ATCTTACAGTTCCATGTGGCTGG - Intergenic
1054509365 9:65956710-65956732 ATCTTACAGTTCCATGTGGCTGG + Intergenic
1054879433 9:70129378-70129400 GACTTACAGTTCCATGTGGCTGG - Intronic
1055083612 9:72291670-72291692 GACTTACAGTTCCATGTGGCTGG + Intergenic
1055240742 9:74183103-74183125 CCCATACACTGCCATGGGGCCGG - Intergenic
1055595451 9:77861067-77861089 GACTTACAGTTCCATGTGGCTGG + Intronic
1055956080 9:81774866-81774888 GACTTACAGTTCCATGTGGCTGG - Intergenic
1056087213 9:83161946-83161968 GACTTACAGTTCCATGTGGCTGG - Intergenic
1056238663 9:84621377-84621399 GACCTACAGTTCCACGTGGCTGG - Intergenic
1056473700 9:86931361-86931383 GACTTACAGTTCCATGTGGCTGG - Intergenic
1056595038 9:88001055-88001077 GACTTACAGTTCCATGTGGCTGG - Intergenic
1058076996 9:100661318-100661340 GACTTACAGTTCCATGTGGCTGG + Intergenic
1058834301 9:108847744-108847766 GACTTACAGTTCCATGTGGCTGG + Intergenic
1059731722 9:117063539-117063561 GACTTACAGTTCCATGTGGCTGG - Intronic
1059800967 9:117749218-117749240 GACATACAGTTCCATGTGGCTGG + Intergenic
1060313850 9:122489810-122489832 CCCTTACAGATACATGGGGAAGG + Intergenic
1060399765 9:123341570-123341592 AGCCTACAATTCCATGGTGCAGG - Intergenic
1060622533 9:125081063-125081085 GACTTACAGTTCCATGTGGCTGG - Intronic
1060653422 9:125351080-125351102 GACTTACAGTTCCATGTGGCTGG + Intronic
1061886574 9:133593948-133593970 CACCCCCAGATCCATGGGGCTGG + Intergenic
1062021923 9:134323793-134323815 GCCCTTCTCTTCCATGGGGCAGG - Intronic
1062038876 9:134395191-134395213 CTCCCACATGTCCATGGGGCTGG + Intronic
1062508830 9:136893557-136893579 ACCCTGCAGACCCATGGGGCTGG - Intronic
1186170378 X:6870538-6870560 GACTTACAGTTCCATGTGGCTGG - Intergenic
1186222601 X:7365705-7365727 GACTTACAGTTCCATGTGGCTGG - Intergenic
1186277722 X:7957955-7957977 CACACACAGTTCCATGTGGCTGG + Intergenic
1186797485 X:13061326-13061348 GACTTACAGTTCCATGTGGCTGG + Intergenic
1186894949 X:13996393-13996415 GACCTACAGTTCCACGTGGCTGG + Intergenic
1186954588 X:14668569-14668591 GACTTACAGTTCCATGTGGCAGG + Intronic
1187051696 X:15702653-15702675 CACCAACTGTTGCATGGGGCAGG - Intronic
1187585261 X:20653753-20653775 CACTTACAGTTCCACGTGGCTGG - Intergenic
1187745242 X:22402428-22402450 GACTTACAGTTCCATGTGGCTGG + Intergenic
1187854004 X:23619222-23619244 GACTTACAGTTCCATGTGGCTGG + Intergenic
1188449447 X:30294092-30294114 GACTTACAGTTCCATGTGGCTGG - Intergenic
1188713412 X:33430566-33430588 GACTTACAGTTCCATGTGGCTGG + Intergenic
1189382346 X:40511000-40511022 AACTCACAGTTCCATGGGGCTGG - Intergenic
1189408566 X:40748533-40748555 ACTCAACAGTTCCATGTGGCTGG - Intergenic
1189637045 X:43022605-43022627 GACTTACAGTTCCATGTGGCTGG + Intergenic
1189979606 X:46495961-46495983 GACTTACAGTTCCATGTGGCTGG + Intronic
1189979760 X:46497395-46497417 GACTTACAGTTCCATGTGGCTGG + Intronic
1190734828 X:53249354-53249376 CCCCTAGATTTCCAGGGAGCTGG + Intronic
1191923078 X:66278364-66278386 CACTTACAGTTCCACGTGGCTGG + Intergenic
1192270668 X:69576264-69576286 GACTTACAGTTCCATGTGGCTGG + Intergenic
1193485087 X:82077845-82077867 GACTTACAGTTCCATGTGGCTGG + Intergenic
1193529718 X:82642240-82642262 GACTTACAGTTCCATGTGGCTGG + Intergenic
1193644693 X:84053174-84053196 GACTTACAGTTCCATGTGGCTGG - Intergenic
1193918897 X:87401183-87401205 GACTTACAGTTCCATGTGGCTGG - Intergenic
1194042887 X:88963291-88963313 AACTTACAGTTCCATGGGGCTGG - Intergenic
1194413963 X:93587884-93587906 CCCCTCCAGTTCGGTGGTGCAGG + Intergenic
1194838828 X:98714346-98714368 GACCCACAGTTCCATGTGGCTGG - Intergenic
1196243928 X:113376037-113376059 GACTTACAGTTCCATGTGGCTGG + Intergenic
1196391204 X:115209498-115209520 GACTTACAGTTCCATGTGGCTGG - Intronic
1196543198 X:116933598-116933620 CACTTACAGTTTCATGTGGCTGG - Intergenic
1197215204 X:123860368-123860390 CCCCTCCACTTCCCTCGGGCCGG + Intronic
1197413175 X:126142998-126143020 GACTTACAGTTCCATGTGGCTGG + Intergenic
1197482812 X:127007889-127007911 AACCAACAGTTCCATGTGGCTGG - Intergenic
1197547186 X:127839306-127839328 GACTTACAGTTCCATGTGGCTGG + Intergenic
1197706954 X:129641024-129641046 TCCCTACAGGTCCCTGGGTCAGG + Intergenic
1197856702 X:130920527-130920549 GACTTACAGTTCCATGTGGCTGG + Intergenic
1197911163 X:131483631-131483653 GACTTACAGTTCCATGTGGCTGG - Intergenic
1198857652 X:141034491-141034513 GCCTTACGGTTCCATGTGGCTGG - Intergenic
1198905046 X:141552880-141552902 GCCTTACGGTTCCATGTGGCTGG + Intergenic
1199147582 X:144387538-144387560 GACTTACAGTTCCACGGGGCTGG + Intergenic
1199277984 X:145969025-145969047 GACCTACAGTTCCACGTGGCTGG - Intergenic
1199515384 X:148669472-148669494 GACTTACAGTTCCATGTGGCTGG + Intronic
1199590635 X:149465212-149465234 GACTTACAGTTCCATGTGGCTGG + Intergenic
1200746225 Y:6906176-6906198 CTCTTACAGTTCCATGAGGCTGG - Intergenic
1201592246 Y:15628079-15628101 GACTTACAGTTCCATGTGGCTGG - Intergenic