ID: 1180850712

View in Genome Browser
Species Human (GRCh38)
Location 22:19018690-19018712
Sequence GTCTGCATTTAGGCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 1, 2: 29, 3: 5, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180850712_1180850722 21 Left 1180850712 22:19018690-19018712 CCCACAGGGGCCTAAATGCAGAC 0: 1
1: 1
2: 29
3: 5
4: 90
Right 1180850722 22:19018734-19018756 GGAACCCTTCTCTGATCATCAGG No data
1180850712_1180850715 -10 Left 1180850712 22:19018690-19018712 CCCACAGGGGCCTAAATGCAGAC 0: 1
1: 1
2: 29
3: 5
4: 90
Right 1180850715 22:19018703-19018725 AAATGCAGACTGTGCATCCCCGG 0: 1
1: 27
2: 2
3: 16
4: 458
1180850712_1180850716 0 Left 1180850712 22:19018690-19018712 CCCACAGGGGCCTAAATGCAGAC 0: 1
1: 1
2: 29
3: 5
4: 90
Right 1180850716 22:19018713-19018735 TGTGCATCCCCGGTGCCCTCAGG 0: 1
1: 0
2: 28
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180850712 Original CRISPR GTCTGCATTTAGGCCCCTGT GGG (reversed) Intergenic
907277308 1:53323970-53323992 GGCTGCATTCTGGCCCCTTTGGG + Intronic
918011953 1:180595158-180595180 GTCTGCATTTCTTCCCCTGTTGG - Intergenic
919776978 1:201200535-201200557 GTCTCCATCTAGTCCCCAGTGGG + Intronic
920986526 1:210895654-210895676 GTCTGTCTGTAGACCCCTGTTGG - Intronic
1063093702 10:2890526-2890548 GTCTGCAATCAGTCCCCTGCAGG - Intergenic
1063694728 10:8322864-8322886 TTCTGCATTAAGGCACTTGTGGG + Intergenic
1066036438 10:31491970-31491992 GTCTGAATTTAGGAATCTGTTGG + Intronic
1076737437 10:132465111-132465133 GTCAGCCTTTGAGCCCCTGTGGG - Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1082164918 11:48936074-48936096 GACTGCATTGAGGCCTTTGTTGG - Intergenic
1086769026 11:90737575-90737597 TTCTTCATTTAGGCCCCATTTGG - Intergenic
1090321227 11:125845180-125845202 GTCTGGAGGGAGGCCCCTGTTGG - Intergenic
1090364804 11:126196960-126196982 GTCTGCATAGATGCCCCTGTTGG - Intergenic
1092556853 12:9569100-9569122 GGCTGCATTCGGACCCCTGTCGG + Intergenic
1094515550 12:31123107-31123129 GGCTGCATTCGGACCCCTGTCGG - Intergenic
1102903591 12:116657975-116657997 GTCTGCATGAAAGCCCTTGTAGG + Intergenic
1102916121 12:116753761-116753783 GACAGGATTTAGGTCCCTGTGGG - Intronic
1108053233 13:46464755-46464777 GGCTGCGTTTGGACCCCTGTCGG - Intergenic
1108053535 13:46465923-46465945 GGCTGCGTTTGGACCCCTGTCGG - Intergenic
1109157284 13:58926509-58926531 GTCTCCAATTAGGCCCAAGTAGG - Intergenic
1110611372 13:77491770-77491792 GTTTGAATTTAGGTCCCTGATGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1118053662 14:62056314-62056336 GGCTGTATTTAGGCCCCTAAAGG - Intronic
1119799076 14:77426573-77426595 GACTGCATTTAGCAGCCTGTCGG - Intergenic
1121457142 14:94045694-94045716 GTTTTCATTTTGGCCCCTGCAGG + Exonic
1121813243 14:96909913-96909935 GTCACCATGTAGGCCACTGTGGG + Intronic
1121896662 14:97654867-97654889 GTCTGCATGTAAGCTCCTGGAGG + Intergenic
1122156190 14:99751833-99751855 GACTGCAGATAGACCCCTGTGGG - Intronic
1127574681 15:60279440-60279462 GTCTGGTTTGAGGTCCCTGTGGG + Intergenic
1128293436 15:66497066-66497088 GTCGGGATTTAGGCCCACGTGGG - Intronic
1130298172 15:82661878-82661900 GTCTCCATTCAGCCACCTGTTGG - Exonic
1131266203 15:90916792-90916814 GTCTGCACTTATGTCCCTCTGGG - Intronic
1131594022 15:93778632-93778654 GACTGCTTGTAGGCCCTTGTAGG - Intergenic
1132592540 16:732461-732483 GTCTGCACTTTGGCCCCAGAAGG + Intronic
1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG + Intronic
1134564035 16:15235793-15235815 TTCTGCACTTAAGCTCCTGTAGG + Intergenic
1134738459 16:16520902-16520924 TTCTGCACTTAAGCTCCTGTAGG - Intergenic
1134929042 16:18191258-18191280 TTCTGCACTTAAGCTCCTGTAGG + Intergenic
1140228175 16:73095503-73095525 GTCAGCACTTGGGCCGCTGTGGG - Intergenic
1140580455 16:76225106-76225128 TTCTGCATTTTGGTCTCTGTTGG + Intergenic
1141750311 16:85953934-85953956 GTCTGCCTGTAGGTCCATGTAGG + Intergenic
1143405536 17:6675004-6675026 CTCTGAATTTAGGCCCCTTTGGG - Intergenic
1145016185 17:19399932-19399954 CTCTGCATGTAAGCCTCTGTTGG - Intergenic
1145804126 17:27714335-27714357 GTCTGAGTCTAGGTCCCTGTGGG - Intergenic
1145841626 17:28000002-28000024 GTCTGCATAAAGGACCCAGTCGG - Intergenic
1149565739 17:57639527-57639549 GTATGCATAAAGGCCCCAGTCGG - Intronic
1149980755 17:61309444-61309466 GTCCACAGTTATGCCCCTGTCGG - Intronic
1156484072 18:37453729-37453751 GTCTGCATTTGAGGCCCTGATGG - Intronic
1157991454 18:52501667-52501689 GTCAGAATTTAAGCCCATGTCGG + Intronic
1158690971 18:59660129-59660151 GGCTGGATTTCGGCCCCTTTCGG - Intronic
1160994252 19:1875127-1875149 GGCTGTATTTAGGCCCCTAAAGG - Intergenic
1161744075 19:6044230-6044252 GGCTGCATCTGGGCCCCTTTGGG + Exonic
1164509933 19:28888822-28888844 GTCAGCATCTAGGGCCCTATTGG + Intergenic
1165978555 19:39699255-39699277 GGCAGCATGTAGGACCCTGTAGG - Intergenic
925599985 2:5598443-5598465 CTGTTCATTTAGGCTCCTGTAGG - Intergenic
929548489 2:42873850-42873872 GTCTGGATTGAGACCCCTTTCGG - Intergenic
931336016 2:61344809-61344831 GGGTGAATTTAGGCCCCTGGGGG + Intronic
932399947 2:71473432-71473454 GTCTGCATCTAGGCTGCTGCAGG + Intronic
940352095 2:152702159-152702181 GTGGGAATTTAGGCCCCTCTTGG - Intronic
944984113 2:205155189-205155211 GGCTGAATTCAGGCCCCAGTGGG - Intronic
945022178 2:205584925-205584947 GTCTGCATGTAGCCACTTGTGGG - Intronic
946967347 2:225051254-225051276 TTCTGGATTTAGCCCTCTGTTGG + Intergenic
947304240 2:228725788-228725810 TTCTGAATTTATGCCCCTATGGG - Intergenic
1171292309 20:23989375-23989397 GTCTGCATTTCGGCCCCTGCGGG + Intergenic
1173189015 20:40862171-40862193 GTCTTCATTTAGGTTCCTGCAGG - Intergenic
1174752392 20:53124279-53124301 GTCTGCAATCAGGCTTCTGTTGG + Intronic
1174787051 20:53442722-53442744 GCCGGCATTTAGGCCTCAGTTGG + Intronic
1178367407 21:31999082-31999104 ATCTGCAGATAGGCCCCTGGAGG + Exonic
1179415905 21:41198601-41198623 GACTGCATGGAGACCCCTGTTGG - Intronic
1180823377 22:18847138-18847160 GTCTGCATTTCGGCCCCTGCGGG + Exonic
1180848422 22:18997370-18997392 GTCTGCATTTCGGCCCCTGTGGG - Intergenic
1180850712 22:19018690-19018712 GTCTGCATTTAGGCCCCTGTGGG - Intergenic
1181123801 22:20690237-20690259 GTCTGCATTTCGGCCCCTGCGGG + Intergenic
1181189366 22:21127408-21127430 GTCTGCATTTCGGCCCCTGCGGG - Exonic
1181209833 22:21283087-21283109 GTCTGCATTTCGGCCCCTGCGGG + Intergenic
1181399683 22:22643857-22643879 GTCTGCATTTCGGCCCCTGCGGG - Intergenic
1181649732 22:24252211-24252233 GTCTGCATTTCGGCCCCTGCGGG + Intergenic
1181707640 22:24658535-24658557 GTCTGCATTTCGGCCCCTGCGGG - Intergenic
1183435294 22:37790629-37790651 AGCTGCATTTGGGCCCCAGTTGG + Intergenic
1203217112 22_KI270731v1_random:12346-12368 GTCTGCATTTCGGCCCCTGCGGG - Intergenic
1203273517 22_KI270734v1_random:73044-73066 GTCTGCATTTCGGCCCCTGCGGG + Intergenic
949883883 3:8679785-8679807 GGCTGCGTTCAGACCCCTGTGGG - Intronic
949890959 3:8733479-8733501 GTCAGCATTTTGGCTCCTTTGGG - Intronic
960279990 3:115770449-115770471 GTTAGTAATTAGGCCCCTGTAGG - Intergenic
968395728 4:234851-234873 GTCTGAATTTAGGCGCCTGCAGG - Intergenic
968414583 4:419127-419149 GCCTGGATTTAGGCACCTGCAGG - Intergenic
970941638 4:21641159-21641181 TTGTGCATTTAGGGCCCTCTTGG - Intronic
981983832 4:150829703-150829725 GTCTGCATTTAGTCCCTTCGTGG + Intronic
982327495 4:154143913-154143935 GTTTGCATTTATGCACCTGCAGG - Intergenic
983428386 4:167616836-167616858 GTCTAGATTTAGTCCCTTGTTGG + Intergenic
984951447 4:185010794-185010816 GTCTGCATTTAGGACCCACCAGG - Intergenic
987708667 5:21483906-21483928 GTCTGCATTTTGGCCCCTGCGGG - Intergenic
988750942 5:34190239-34190261 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
989184739 5:38612597-38612619 GTTTGCATTTTGGCTGCTGTTGG + Intergenic
991736081 5:69632163-69632185 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
991739211 5:69653451-69653473 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
991758987 5:69902980-69903002 GTCTGCATTTTGGCCCCTGCGGG - Intergenic
991788349 5:70215142-70215164 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
991790786 5:70233192-70233214 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
991812581 5:70487802-70487824 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
991815538 5:70508279-70508301 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
991818672 5:70529568-70529590 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
991838216 5:70778046-70778068 GTCTGCATTTTGGCCCCTGCGGG - Intergenic
991880796 5:71215506-71215528 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
991883233 5:71233527-71233549 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
992773219 5:80068560-80068582 GTCTGCCTTGACGCTCCTGTTGG + Intronic
994420728 5:99524932-99524954 GTCTGCATTTCGGCCCCTGCGGG - Intergenic
994420799 5:99525256-99525278 GTCTGCATTTCGGCCCCTGCGGG - Intergenic
994486244 5:100389058-100389080 GTCTGCATTTCGGCCCCTGCGGG + Intergenic
994486315 5:100389382-100389404 GTCTGCATTTCGGCCCCTGCGGG + Intergenic
997049250 5:130359132-130359154 GTCTGCATTCTAGCCCCTGATGG + Intergenic
998556071 5:143124852-143124874 GTTTGCATTTAGTTCCCTTTAGG + Intronic
1005549019 6:26896544-26896566 GTCTGCATTTTGGCCCCTGCGGG + Intergenic
1009019764 6:57937654-57937676 GTCTGCATTTTGGCCCCTGCAGG + Intergenic
1009019832 6:57937978-57938000 GTCTACAGTTCGGCCCCTGCGGG + Intergenic
1020033732 7:4951250-4951272 GTCTGGATTTGGGCTCCAGTGGG - Intronic
1022665435 7:32406119-32406141 GTGTGCTTTTAGGCCTCTGTGGG - Intergenic
1022785682 7:33634831-33634853 GTCGTCATTTAGCCCACTGTGGG - Intergenic
1035103231 7:156418244-156418266 GTGTGTACTTGGGCCCCTGTAGG - Intergenic
1036709836 8:11071211-11071233 CTCAGCATTTAGGGCCCTGGAGG + Intronic
1039025830 8:33256919-33256941 TTCTGCATTTTGGGGCCTGTGGG - Intergenic
1041052761 8:53953949-53953971 ATATGCATTTAGGCCCTTTTAGG - Intronic
1047159588 8:122362893-122362915 GTCTGAATCTAGCTCCCTGTTGG - Intergenic
1060496021 9:124119089-124119111 GTATGCATGTATGCCCATGTGGG + Intergenic
1196515504 X:116606152-116606174 GGCTGCATTTAGGCCCACCTAGG + Intergenic
1201713833 Y:17021466-17021488 ATCTGCATTTAGGCCAAGGTAGG - Intergenic