ID: 1180851331

View in Genome Browser
Species Human (GRCh38)
Location 22:19023258-19023280
Sequence GAGGGTGTGCACAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180851331_1180851351 25 Left 1180851331 22:19023258-19023280 CCCTGCCCCTTGTGCACACCCTC No data
Right 1180851351 22:19023306-19023328 GTGTTTGCAGTGCTACAGGGTGG No data
1180851331_1180851350 22 Left 1180851331 22:19023258-19023280 CCCTGCCCCTTGTGCACACCCTC No data
Right 1180851350 22:19023303-19023325 CCTGTGTTTGCAGTGCTACAGGG No data
1180851331_1180851348 21 Left 1180851331 22:19023258-19023280 CCCTGCCCCTTGTGCACACCCTC No data
Right 1180851348 22:19023302-19023324 GCCTGTGTTTGCAGTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180851331 Original CRISPR GAGGGTGTGCACAAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr