ID: 1180851800

View in Genome Browser
Species Human (GRCh38)
Location 22:19025594-19025616
Sequence ACACCCTCCCAGCCAGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180851797_1180851800 15 Left 1180851797 22:19025556-19025578 CCTAGAGTAGACTAAGCTGGCCG No data
Right 1180851800 22:19025594-19025616 ACACCCTCCCAGCCAGCCGCTGG No data
1180851798_1180851800 -5 Left 1180851798 22:19025576-19025598 CCGCTGCCATGCTAACACACACC No data
Right 1180851800 22:19025594-19025616 ACACCCTCCCAGCCAGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180851800 Original CRISPR ACACCCTCCCAGCCAGCCGC TGG Intergenic
No off target data available for this crispr