ID: 1180855050

View in Genome Browser
Species Human (GRCh38)
Location 22:19040375-19040397
Sequence TAGGCAGTGCCACCCCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180855050_1180855059 25 Left 1180855050 22:19040375-19040397 CCACTTTGGGGTGGCACTGCCTA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1180855059 22:19040423-19040445 GTTAGGGGGCCTAATGCACAGGG No data
1180855050_1180855058 24 Left 1180855050 22:19040375-19040397 CCACTTTGGGGTGGCACTGCCTA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1180855058 22:19040422-19040444 TGTTAGGGGGCCTAATGCACAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1180855050_1180855056 10 Left 1180855050 22:19040375-19040397 CCACTTTGGGGTGGCACTGCCTA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1180855056 22:19040408-19040430 TACAGGTTTGTGTGTGTTAGGGG 0: 1
1: 0
2: 1
3: 37
4: 370
1180855050_1180855051 -7 Left 1180855050 22:19040375-19040397 CCACTTTGGGGTGGCACTGCCTA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1180855051 22:19040391-19040413 CTGCCTACCAAATATACTACAGG 0: 1
1: 0
2: 0
3: 24
4: 491
1180855050_1180855054 8 Left 1180855050 22:19040375-19040397 CCACTTTGGGGTGGCACTGCCTA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1180855054 22:19040406-19040428 ACTACAGGTTTGTGTGTGTTAGG 0: 1
1: 0
2: 2
3: 31
4: 235
1180855050_1180855057 11 Left 1180855050 22:19040375-19040397 CCACTTTGGGGTGGCACTGCCTA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1180855057 22:19040409-19040431 ACAGGTTTGTGTGTGTTAGGGGG No data
1180855050_1180855055 9 Left 1180855050 22:19040375-19040397 CCACTTTGGGGTGGCACTGCCTA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1180855055 22:19040407-19040429 CTACAGGTTTGTGTGTGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180855050 Original CRISPR TAGGCAGTGCCACCCCAAAG TGG (reversed) Intronic
900641604 1:3690366-3690388 AAGGCTGGGCCACCCCAAGGGGG - Intronic
901214681 1:7548883-7548905 TGGGCACTTCCACCCCTAAGGGG - Intronic
902573380 1:17361139-17361161 TAGGCAGTGCCAGCCCCACCTGG + Intronic
903035843 1:20492052-20492074 GAGGCAGTGCCACCCAACAGTGG - Intergenic
903918723 1:26784284-26784306 CAGCCACTGCCACCCCCAAGTGG + Intergenic
904056419 1:27673524-27673546 TATTCAGTGCCACCCCCAAATGG + Intergenic
905187888 1:36209840-36209862 CATTCACTGCCACCCCAAAGGGG + Intergenic
907054144 1:51349458-51349480 TATGCAAAGTCACCCCAAAGAGG + Intergenic
911275436 1:95853297-95853319 TAGGCAGTGGCACCTGGAAGGGG - Intergenic
911769004 1:101715320-101715342 TATGCCCAGCCACCCCAAAGAGG + Intergenic
912142382 1:106747347-106747369 TAGTCAGTGTTACCACAAAGAGG - Intergenic
915108410 1:153548293-153548315 TAGGCAGTGCCTCCCCCCGGAGG + Intronic
918453904 1:184687542-184687564 TAGAGAGTGACTCCCCAAAGGGG - Intergenic
1063020684 10:2124413-2124435 TGGGAAGTGCAACCTCAAAGAGG + Intergenic
1067050144 10:43011071-43011093 CAGGCAGTCCCATCCCAAAAGGG - Intergenic
1070419590 10:76223664-76223686 TAGGCAGTGCAGCTCCAGAGAGG + Intronic
1070499663 10:77060413-77060435 TAGACAGTGCCATTCCAAAAGGG - Intronic
1071394737 10:85211642-85211664 TAGACACTGCCTCCTCAAAGTGG - Intergenic
1078103067 11:8341233-8341255 CAAGCACTGCCACCCCGAAGAGG - Intergenic
1078878180 11:15419329-15419351 TAGGCAGAACAACCCCAAACTGG + Intergenic
1079161151 11:17995337-17995359 CAGGCAGGCACACCCCAAAGAGG - Intronic
1086993375 11:93330381-93330403 TAGGCAGTGGGACTACAAAGAGG + Intronic
1090442457 11:126735727-126735749 TAGGCAGAACCAAACCAAAGAGG + Intronic
1096537700 12:52286071-52286093 TGGGCTCTGCCACCCCACAGTGG - Exonic
1096590995 12:52659214-52659236 TTGGCAATGCCACACCGAAGAGG - Intergenic
1097554089 12:61115705-61115727 TAGGCAGTGCCATGCCCCAGTGG - Intergenic
1101924677 12:108961186-108961208 TGGGGAGTGCCAACCCACAGGGG + Intronic
1104520456 12:129469669-129469691 GAGGGAGTGCCACACCAGAGTGG - Intronic
1105837683 13:24225067-24225089 GAGGCACTGCCAGCCCACAGAGG - Intronic
1106590387 13:31093503-31093525 GAGGCAGTGTTCCCCCAAAGGGG + Intergenic
1113772206 13:112917445-112917467 GAGGCAGCGCGACCTCAAAGTGG - Intronic
1114152166 14:20054559-20054581 GAGGCAGAACCACCCCCAAGAGG - Intergenic
1114667472 14:24387915-24387937 TAGCCAGATCCACCCCAAACTGG - Intergenic
1117050082 14:51851013-51851035 TAGGCAATGCCAACCCACCGTGG + Intronic
1117772724 14:59151106-59151128 TGGGCAGGGCCAGTCCAAAGAGG + Intergenic
1118837623 14:69487810-69487832 TGGGCAGTGCCAGGACAAAGAGG + Intronic
1122608780 14:102966763-102966785 GAGGCAGAGCCCTCCCAAAGCGG - Intronic
1124168912 15:27354496-27354518 CAGGCAGTGCCACCCACACGGGG - Intronic
1124415495 15:29470283-29470305 GAGGCAGTGCCAGCCCACTGAGG + Intronic
1130272372 15:82458744-82458766 TATGCAGTGTCAAACCAAAGTGG - Intergenic
1130464723 15:84186097-84186119 TATGCAGTGTCAAACCAAAGTGG - Intergenic
1130487962 15:84408707-84408729 TATGCAGTGTCAAACCAAAGTGG + Intergenic
1130499543 15:84487440-84487462 TATGCAGTGTCAAACCAAAGTGG + Intergenic
1130587015 15:85190711-85190733 TATGCAGTGTCAAACCAAAGTGG - Intergenic
1136495442 16:30640552-30640574 GGGGCAGTGCCACCCCTTAGGGG - Intergenic
1139975634 16:70807876-70807898 GAGGCAGAGCCATTCCAAAGAGG + Exonic
1142159359 16:88548569-88548591 GAGGCAGCGCCACCCCGAACAGG + Intergenic
1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG + Intronic
1144413523 17:15023904-15023926 TATGCAGGGGCACCCAAAAGGGG - Intergenic
1144766904 17:17737996-17738018 GAGGCAGTGCCATCCCAGGGGGG + Intronic
1147591966 17:41689409-41689431 AAGGCGGTGCCAGCCCTAAGTGG + Intronic
1147946129 17:44081109-44081131 TACACAGTGCCACCCCACAGAGG - Intronic
1150130379 17:62665944-62665966 GAGGCAATGGCACCCCATAGTGG - Intronic
1151001450 17:70381542-70381564 TTAGCAGTGCAGCCCCAAAGAGG + Intergenic
1159064549 18:63555462-63555484 CAGGGAGTTCCACCACAAAGTGG + Intergenic
1159947024 18:74451368-74451390 AAGCCAGTCCCACCCCTAAGTGG + Intronic
1163622362 19:18368692-18368714 TAGACAGTGGCAGCCAAAAGGGG - Exonic
1165803652 19:38567549-38567571 CAGGCAGTGACAGCCCAGAGTGG - Intronic
1166308428 19:41948662-41948684 CAGACACTGCCACCCCAAACGGG + Intergenic
1166697987 19:44865191-44865213 CAGGCAGGGCCACCACGAAGGGG - Intronic
926287753 2:11503562-11503584 TTGGCAGTGCCTACACAAAGTGG - Intergenic
931157454 2:59651721-59651743 TAGGAAGTGTCTCCCCAAAGAGG - Intergenic
948534877 2:238638291-238638313 TAGGCAGTGGCGCCCCAAGATGG + Intergenic
1173222146 20:41139027-41139049 CAGGAAGTGACACCCCAAGGGGG + Intronic
1174448097 20:50603671-50603693 AGGGCAGTGCCACCCCCATGGGG - Intronic
1174696607 20:52565750-52565772 TAGGCAGGGCCACCTGGAAGAGG - Intergenic
1180080971 21:45487369-45487391 CGGGCAGTGCCACCCCAGGGAGG + Intronic
1180086358 21:45509600-45509622 TGGTGAGTGCCCCCCCAAAGTGG + Exonic
1180855050 22:19040375-19040397 TAGGCAGTGCCACCCCAAAGTGG - Intronic
1181913137 22:26256539-26256561 GCCTCAGTGCCACCCCAAAGAGG + Intronic
1182092291 22:27604042-27604064 GAGGCAGTGCCAGCCCAGGGAGG - Intergenic
1182222416 22:28769425-28769447 AAGGCAGTGCAAACCCAGAGTGG - Intergenic
950344813 3:12283816-12283838 TAGGCAGTGCCATCCATATGGGG - Intergenic
951536375 3:23744293-23744315 TAGGCAGGGAAACCCCACAGAGG + Intergenic
952159212 3:30676779-30676801 TAGGAAGTGCCATCCCCATGCGG - Intronic
953482195 3:43261317-43261339 TAGGCAGTGGAAACCCAAAGGGG - Intergenic
953820463 3:46203680-46203702 AAGGCAATACCAGCCCAAAGAGG + Exonic
954673548 3:52303490-52303512 ATGGCAGTGCCAACCCCAAGAGG + Intergenic
958950556 3:100411205-100411227 TAGACAGTCCCACTCCAAAAGGG - Intronic
964866263 3:161265394-161265416 TAGTCACTGCCTCCCCAAACTGG + Intergenic
968643299 4:1725875-1725897 AAGGCAGTGCCGCCCCAAGGTGG + Intronic
968903801 4:3442834-3442856 GAGGCAGAGGGACCCCAAAGTGG + Exonic
970104553 4:12566479-12566501 TAGGCAATTCCACACCTAAGAGG - Intergenic
971943579 4:33245815-33245837 TAGGGAGTGCCACCCCAGTGGGG + Intergenic
973694800 4:53479949-53479971 TAGGCCTTGCCTCCCCACAGAGG + Intronic
976470945 4:85428477-85428499 AAGGTAGTGCCACCCTGAAGAGG + Intergenic
980120731 4:128725300-128725322 TTGGCTGTCCCACCCCAAAAGGG - Intergenic
981758335 4:148166358-148166380 TGGGCAGGGCCACGCCAGAGTGG + Intronic
982305065 4:153922287-153922309 TAGTCTGTGCCAGCCCAAAATGG - Intergenic
989197753 5:38732239-38732261 AAGGCAGAGGCACCCCAGAGAGG + Intergenic
990510958 5:56488580-56488602 AAGGCAGTGCGGCCCCAAACAGG - Intergenic
991081932 5:62609992-62610014 TAGGCAGTGCTTCCCTAAATGGG - Intronic
998956051 5:147439493-147439515 TAGGCAGGGCCACTCCACATGGG + Intronic
1003590484 6:7432796-7432818 TAGGGAGGGCCACACCAAAGGGG + Intergenic
1003964589 6:11241172-11241194 TGGGCAGTGCCTCCGGAAAGAGG - Intronic
1004139392 6:13001701-13001723 AAGACAGTGCTTCCCCAAAGTGG - Intronic
1006419919 6:33926475-33926497 TGAGCAGTGCAGCCCCAAAGTGG - Intergenic
1006428858 6:33982904-33982926 GAGGCAGTGCCTGTCCAAAGGGG + Intergenic
1007239711 6:40416326-40416348 TAGCCAGTGGCACCCAACAGTGG + Intronic
1007343359 6:41208171-41208193 TATGCAGTGGTACCCCAAATTGG + Intergenic
1007664873 6:43508259-43508281 GAGGCAGTGACAGCCCAAGGGGG + Intronic
1008714677 6:54274287-54274309 TTGGCAGTGCTACCCAAATGGGG + Intergenic
1010097006 6:72058457-72058479 CAGGCAGTGCAACCCCAGAGGGG - Intronic
1018573406 6:165233770-165233792 CAGGCAGTGCCAGCCACAAGAGG + Intergenic
1020485609 7:8716273-8716295 TAGTCAGGGCCACCTTAAAGGGG - Intronic
1023348604 7:39296692-39296714 CTGCCAGTGCCACCCCAGAGGGG + Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1026252990 7:68687016-68687038 TAGGCAGGACCAGCCCAAACTGG + Intergenic
1026648953 7:72198021-72198043 TAGGCACTTCCCCTCCAAAGAGG - Intronic
1029514187 7:101015787-101015809 CAGTCACAGCCACCCCAAAGGGG - Intronic
1030065687 7:105657078-105657100 TAAGCAGTGCCAACCCATACTGG - Intronic
1030772086 7:113487600-113487622 AAGGCAGTGCGGACCCAAAGAGG + Intergenic
1032489020 7:132309967-132309989 TAGGCACCGCCACCCTAGAGTGG + Intronic
1034150549 7:148911769-148911791 ATGGCAGTGTCACTCCAAAGAGG - Intergenic
1034386165 7:150742865-150742887 CAGGCAGTACCAGGCCAAAGTGG + Exonic
1039102585 8:33957268-33957290 TAGGCAGGGCCACCCAACATGGG - Intergenic
1039475376 8:37836828-37836850 AAGGCACTGCCACCCCACCGTGG + Intronic
1039966853 8:42290153-42290175 TAGGCTGACCCACCCCAATGTGG + Exonic
1040953018 8:52954759-52954781 AAGGCAGTGCAGACCCAAAGAGG - Intergenic
1042274109 8:66985494-66985516 TGGGCATTGCTTCCCCAAAGGGG - Intronic
1044828485 8:96221763-96221785 TAGGCACAGCCACCCCATGGAGG - Intergenic
1045349228 8:101322985-101323007 GATGAAGTGCCACACCAAAGGGG + Intergenic
1045731139 8:105242357-105242379 TGGGCAATGCCACCCCAAAAAGG + Intronic
1057643526 9:96852150-96852172 TAGACAGTGCCACCTCTACGTGG - Intronic
1060232724 9:121837715-121837737 GAGGCAGTGCCACCCCAGGAGGG - Intronic
1060891143 9:127189339-127189361 GAGGCAATGCCAGTCCAAAGCGG - Intronic
1061893081 9:133633014-133633036 CAGGCAGTGACAACCCCAAGTGG - Intergenic
1197058453 X:122148431-122148453 TAGGCATACCCATCCCAAAGTGG - Intergenic
1202370495 Y:24192576-24192598 TATGCAGTGTCAAACCAAAGTGG + Intergenic
1202500289 Y:25477541-25477563 TATGCAGTGTCAAACCAAAGTGG - Intergenic