ID: 1180856965

View in Genome Browser
Species Human (GRCh38)
Location 22:19053541-19053563
Sequence GGAGGTCTTTAGTACAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180856965_1180856972 6 Left 1180856965 22:19053541-19053563 CCTGCACTGTACTAAAGACCTCC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1180856972 22:19053570-19053592 GAAAGGCCTAGTGGAAGTAAAGG 0: 1
1: 0
2: 1
3: 13
4: 174
1180856965_1180856968 -3 Left 1180856965 22:19053541-19053563 CCTGCACTGTACTAAAGACCTCC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1180856968 22:19053561-19053583 TCCCCACAAGAAAGGCCTAGTGG 0: 1
1: 0
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180856965 Original CRISPR GGAGGTCTTTAGTACAGTGC AGG (reversed) Intronic
900959015 1:5907550-5907572 GGAGGTGCTCAGTCCAGTGCTGG - Intronic
901220461 1:7580685-7580707 GGAGGGATTTTGCACAGTGCTGG - Intronic
904541902 1:31239213-31239235 GGAGGCCACTTGTACAGTGCGGG + Intronic
908090110 1:60676923-60676945 GGATGTGTATAGTACAGTGAGGG + Intergenic
913011747 1:114690165-114690187 GGAGGTGTTAAGTGCAGAGCAGG - Intronic
913264178 1:117028136-117028158 GGAGGTCCACAGTACAGTGCAGG + Intronic
920112048 1:203593759-203593781 GAAGGTCTTTAGGTCTGTGCAGG + Intergenic
920791549 1:209097566-209097588 GCATGTATTTAGCACAGTGCTGG + Intergenic
921690118 1:218139120-218139142 GGAGGTCTGTAGTAGTGTGGTGG - Intergenic
922066266 1:222146403-222146425 GCAGGGCTTTAGTGCTGTGCTGG - Intergenic
922252504 1:223862739-223862761 GGAACTCTTTTGTACATTGCTGG - Intergenic
1066337263 10:34490741-34490763 GGAGGTCTTAAGTACTGCCCTGG - Intronic
1068214202 10:53962384-53962406 AGAGGACTGTAGTAAAGTGCAGG + Intronic
1070602491 10:77875689-77875711 GGAGGTCTTTAAAACAGAGAAGG - Intronic
1081741855 11:45446505-45446527 TCAGGTGTTTAGTACAATGCCGG - Intergenic
1081749616 11:45500653-45500675 GGAGGTCTTTAGTGCACCTCTGG + Intergenic
1085654347 11:78299044-78299066 GTAGGTCTGGAGTACAGTCCAGG + Intronic
1086326475 11:85706503-85706525 GGAGGTATTTAAGACAGTACAGG + Intronic
1089745200 11:120611911-120611933 TGAGTTCTTTTGTGCAGTGCAGG + Intronic
1090562054 11:127943018-127943040 GGAGGTCTTAAGAAAAGCGCAGG - Intergenic
1101218487 12:102610080-102610102 GCAGGTCCTGAGTAAAGTGCAGG + Intergenic
1102289162 12:111685249-111685271 AAAGGTGCTTAGTACAGTGCTGG + Intronic
1105983382 13:25541664-25541686 GGATGTTTCTAGTACAGTGGTGG + Intronic
1108186977 13:47897730-47897752 GAAGGTCTCTAGTACCTTGCAGG - Intergenic
1111406551 13:87813955-87813977 GTAGGTCTTTAGTAATGTGGTGG - Intergenic
1111442771 13:88302620-88302642 GGAGGTATTTTGGACAGTGGAGG + Intergenic
1111973590 13:94942359-94942381 AGAGTTCTTTAGAACTGTGCTGG - Intergenic
1115647096 14:35376210-35376232 GGAGCTCTTAAGAACAGTGCTGG - Intergenic
1119084880 14:71730509-71730531 GGAGGTCTTGGGTCCAGTGTGGG - Intronic
1122762142 14:104037166-104037188 GGGGGTCTTCAGTACAGAACTGG + Intronic
1125004025 15:34797992-34798014 GGAGGCCAGTAGAACAGTGCAGG + Intergenic
1126681590 15:51207373-51207395 GAAGCCCTTTAGCACAGTGCTGG - Intergenic
1128778718 15:70343436-70343458 ACAGGTTTTTAGCACAGTGCTGG - Intergenic
1131045722 15:89313574-89313596 GGAGGCACTTAGTACATTGCTGG + Intronic
1131349680 15:91687705-91687727 GGAGGTCTTATATACACTGCTGG + Intergenic
1135031160 16:19039784-19039806 AGAGGTATCTAGTACTGTGCAGG - Intronic
1138937154 16:61741002-61741024 CTTGATCTTTAGTACAGTGCTGG - Intronic
1140209392 16:72958904-72958926 GGGGGTCTTCAGTACCGAGCTGG + Exonic
1141100039 16:81190902-81190924 GGGTGTCTTTAGTCCAGTGGTGG - Intergenic
1149659123 17:58325235-58325257 CAAGGTATTTAGCACAGTGCTGG - Intronic
1155272326 18:24152951-24152973 TGAGGCCTGTAGTACAGTGAAGG - Intronic
1164864146 19:31590024-31590046 GGAAGTTCTTAGCACAGTGCAGG - Intergenic
1165556323 19:36635811-36635833 GGAACACTTTAGTACACTGCTGG - Intergenic
1166320691 19:42016801-42016823 GGAGGTGTTTGGTAAAGTGTGGG + Intronic
925284962 2:2709771-2709793 GGAGGTGCTTAGCACAGAGCAGG + Intergenic
928053641 2:28028164-28028186 GGAGGGCCTCAGTTCAGTGCTGG + Intronic
929176686 2:38985269-38985291 ACAGGCCTGTAGTACAGTGCCGG + Exonic
933642862 2:84782757-84782779 GGAGGTCTTCAGTACTGGTCAGG + Intronic
937072420 2:119074129-119074151 GGAAGTAGTTAGTGCAGTGCCGG + Intergenic
939749946 2:146031746-146031768 GGAGGTCAATAGTACAGTTTTGG + Intergenic
944798217 2:203209294-203209316 GGTGGTCTTTTCTTCAGTGCTGG - Exonic
1172860886 20:38050422-38050444 GGAGGTCTTCAGTACAGCTTTGG + Intronic
1173862942 20:46296200-46296222 GGACGTCTGTAGATCAGTGCTGG + Intronic
1175801228 20:61802075-61802097 GGAGGGCTTGAGGACATTGCCGG - Intronic
1176154552 20:63611880-63611902 GTAGATTTTTAGTACAGTGCTGG - Intronic
1179601346 21:42479639-42479661 GGAGGTATTTAGTATTTTGCTGG - Intronic
1180856965 22:19053541-19053563 GGAGGTCTTTAGTACAGTGCAGG - Intronic
1181139869 22:20796545-20796567 GGAGGTCCTTACTACATTTCAGG - Intronic
950111069 3:10419025-10419047 GCAGCTCTTTGGTTCAGTGCTGG + Intronic
950398586 3:12753067-12753089 GCAGGTCTTTAGCACACTGAAGG + Intronic
953201435 3:40781520-40781542 GAAGGTGTTTACTACAGGGCAGG + Intergenic
954754661 3:52832652-52832674 TGAGGTCCCTAGTGCAGTGCAGG + Intronic
954754669 3:52832686-52832708 TGAGGTCCCTAGTGCAGTGCAGG + Intronic
954754677 3:52832720-52832742 TGAGGTCCCTAGTGCAGTGCAGG + Intronic
956258673 3:67312316-67312338 GGATTTCTTGACTACAGTGCCGG - Intergenic
957917303 3:86702800-86702822 GGATGTCTTTATTAGAGTGAAGG + Intergenic
959233474 3:103689141-103689163 AGAGCTCTTTAGTAAAGTGTAGG - Intergenic
961106176 3:124243498-124243520 GGAATTCTTTTGTCCAGTGCTGG - Intronic
963836226 3:150060561-150060583 GGAGGTCTTTAGAACAGTCTGGG + Intergenic
965142282 3:164854326-164854348 GGAAGTCTGTAGTAAACTGCAGG + Intergenic
967775737 3:193384130-193384152 ACAGGACTGTAGTACAGTGCTGG - Intergenic
981105163 4:140872905-140872927 GGAAGTCTTCAGTACAGAGAAGG + Intronic
983493769 4:168419379-168419401 GTAGGTACTTATTACAGTGCCGG - Exonic
984096541 4:175442091-175442113 TGAGGTCCTCAGTACAGAGCAGG - Intergenic
987289106 5:16491128-16491150 GGAGGACATTGGGACAGTGCGGG - Intronic
990490927 5:56302156-56302178 GGAGATCTTTGTTAAAGTGCAGG - Intergenic
991486263 5:67140247-67140269 GGAGGTCGTCAGCACGGTGCGGG - Intronic
1002662103 5:180798183-180798205 TTAGGTGTTTAGAACAGTGCCGG + Intronic
1007662253 6:43494127-43494149 GAAGGTATTTAATACAGGGCAGG + Intronic
1012394278 6:98778129-98778151 GGAGGAGTTTACTCCAGTGCTGG - Intergenic
1014254649 6:119148615-119148637 GGAGGCTTATAGAACAGTGCTGG - Intronic
1016038769 6:139410336-139410358 AGAGATCTTTGGTACAGAGCAGG - Intergenic
1017691776 6:156973299-156973321 CGAGTTCTTTAGAACTGTGCTGG + Intronic
1019754546 7:2759351-2759373 GGAGGCCCTTAGAACAGTGCAGG - Intronic
1020082878 7:5296144-5296166 GGAGGTCTGCAGGACAGGGCCGG - Intronic
1025211390 7:57021044-57021066 GGAGGTCTGCAGGACAGGGCCGG + Intergenic
1025660563 7:63555803-63555825 GGAGGTCTGCAGGACAGGGCCGG - Intergenic
1031865241 7:127031423-127031445 GGAGGTCTCTAGAACATTTCAGG - Intronic
1035000634 7:155609887-155609909 GAAGGTCTTTAGTCCATTGTTGG - Intergenic
1042743434 8:72076568-72076590 GGGGGTCTTGAGTTAAGTGCTGG - Intronic
1045579723 8:103465629-103465651 AGAGTTCTTTAGTCCAGTCCTGG + Intergenic
1048473025 8:134720211-134720233 GTAGTTCTTTTGCACAGTGCAGG - Intergenic
1048608693 8:135997888-135997910 GTAGGTCTTTAGTAAAGTAGTGG - Intergenic
1057438233 9:95062250-95062272 GCAGATCTCTAGTACAGCGCAGG + Intronic
1059044814 9:110854887-110854909 GCAGGTCTGAAGTACAGGGCTGG - Intergenic
1059953300 9:119490191-119490213 GGATCTCTTCAGTACAGTGAGGG - Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060459734 9:123839303-123839325 AGAGGTCTGTTGTACAGTGAAGG - Intronic
1188650025 X:32621141-32621163 GGGGGCCTTTAGTGCAGTACTGG + Intronic
1189748370 X:44193608-44193630 AGAGGTCTCTAGAACAGTCCTGG + Intronic
1194782287 X:98039006-98039028 GGAGGACCTTAGTACAGTGGAGG - Intergenic
1201643245 Y:16200835-16200857 GCAGGTCTCTAGTATATTGCAGG - Intergenic
1201659570 Y:16384486-16384508 GCAGGTCTCTAGTATATTGCAGG + Intergenic