ID: 1180857556

View in Genome Browser
Species Human (GRCh38)
Location 22:19058003-19058025
Sequence TCCAAGAAGCAGAATAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 298}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180857552_1180857556 12 Left 1180857552 22:19057968-19057990 CCCGACCAGGATCAATGGAAACA No data
Right 1180857556 22:19058003-19058025 TCCAAGAAGCAGAATAATGAAGG 0: 1
1: 0
2: 0
3: 28
4: 298
1180857550_1180857556 24 Left 1180857550 22:19057956-19057978 CCTTGAGGCTTACCCGACCAGGA 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1180857556 22:19058003-19058025 TCCAAGAAGCAGAATAATGAAGG 0: 1
1: 0
2: 0
3: 28
4: 298
1180857553_1180857556 11 Left 1180857553 22:19057969-19057991 CCGACCAGGATCAATGGAAACAC 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1180857556 22:19058003-19058025 TCCAAGAAGCAGAATAATGAAGG 0: 1
1: 0
2: 0
3: 28
4: 298
1180857554_1180857556 7 Left 1180857554 22:19057973-19057995 CCAGGATCAATGGAAACACAAAG 0: 1
1: 0
2: 2
3: 17
4: 208
Right 1180857556 22:19058003-19058025 TCCAAGAAGCAGAATAATGAAGG 0: 1
1: 0
2: 0
3: 28
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180857556 Original CRISPR TCCAAGAAGCAGAATAATGA AGG Intronic
900860505 1:5225899-5225921 AGCAAGAAGAAGAATAATAAAGG - Intergenic
905328192 1:37173273-37173295 TCCAAGAAGCAGAGCAATTAGGG - Intergenic
906357920 1:45123653-45123675 TCCCAGAAGCAGAAAAAAGAGGG + Intronic
906938623 1:50236228-50236250 CTCAAGAAGCAGTATAATGTGGG + Intergenic
908125359 1:61024962-61024984 TCATAGAAGCAGAAGAATGATGG + Intronic
909879027 1:80848896-80848918 TCTAAGCAGCAAAATATTGAAGG - Intergenic
910000783 1:82339925-82339947 TCCAAAAGTCAGAAAAATGAAGG + Intergenic
910727109 1:90350631-90350653 ACAAAGGAGAAGAATAATGAAGG + Intergenic
911264540 1:95727438-95727460 TCTAAGAAGCAAAATATTCAAGG - Intergenic
911537495 1:99118023-99118045 TCCAAGAAACAAAAGAATGTGGG + Intergenic
912376411 1:109213455-109213477 TCCAATAATCAGATTAATAAAGG + Intergenic
913334308 1:117694821-117694843 TTCAAGAGGAAGAATAAGGAAGG + Intergenic
914750668 1:150532876-150532898 TCCAAGAAGCAGCATTAGAAAGG - Intergenic
917731148 1:177876245-177876267 TCCAAGAAGCACAAAAAAAAGGG + Intergenic
918649675 1:186945707-186945729 ACCAACAAGAAGAAGAATGAAGG + Intronic
919589762 1:199486532-199486554 TCCCAGAAGGAGAATAAAGGTGG + Intergenic
921237089 1:213144181-213144203 TACAGGAGGCAGAATAATGATGG - Intronic
921595447 1:217049297-217049319 TCCAAGAAGGAGAATGAAGCCGG + Intronic
921904915 1:220486087-220486109 GCCATGCAGCAGAATAATCATGG + Intergenic
923319066 1:232811872-232811894 TCCAAGGAGTAAAATAATCAAGG - Intergenic
1063057057 10:2517069-2517091 TACAAGAAGCAGGATAAGGAAGG - Intergenic
1063162558 10:3429913-3429935 GCCAAGCAGAAGAAAAATGATGG - Intergenic
1063218499 10:3944841-3944863 TCCAAGCAGCAGGATAAGAAGGG + Intergenic
1064570725 10:16690185-16690207 TCTTTGAAGCAGAATTATGATGG - Intronic
1066508858 10:36073178-36073200 ACCAAGAAGCAGAAGACAGATGG + Intergenic
1067834606 10:49630586-49630608 TAAAAGGAGCAGAAAAATGAGGG + Intronic
1075295076 10:121267948-121267970 TGCTAGAAGCAGGATGATGAAGG + Intergenic
1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG + Intronic
1077446839 11:2597626-2597648 TCCAAGACACAGAACAAGGAAGG - Intronic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1079797608 11:24825756-24825778 TTCAAGAAGGAGAAAAATCAGGG - Intronic
1080166166 11:29240458-29240480 CACAAAAAGCAGAATAATAAAGG - Intergenic
1082216706 11:49579430-49579452 TTCAAGAAAGAGAATATTGATGG - Intergenic
1082890185 11:58130827-58130849 TCCTAGAAACAGAACAATGGGGG - Intronic
1082944873 11:58747845-58747867 GTCAATAAGCAGAATAATCATGG + Intergenic
1085229978 11:74958640-74958662 TCCAAGAAGAAGAATACAGGAGG - Intronic
1085647111 11:78231780-78231802 TCCAAGAACCCTAATGATGAAGG + Intronic
1086597892 11:88595726-88595748 TCAAAGAAGAGGAACAATGAGGG - Intronic
1086632847 11:89044653-89044675 TTCAAGAAAGAGAATATTGATGG + Intronic
1086926242 11:92643556-92643578 TCCAACAAGGAGGATGATGAGGG + Intronic
1087509140 11:99068009-99068031 GGCAAGAAGGAGAATAATGCAGG - Intronic
1088093382 11:106069810-106069832 ACCAAAAAGAATAATAATGAGGG + Intronic
1089644669 11:119870891-119870913 TCTAAGAAGGAGAATAAAGAAGG + Intergenic
1090177497 11:124664073-124664095 TCTAAGTAGCTGTATAATGAAGG - Intronic
1091335881 11:134765239-134765261 TTCAAGAGACAGAGTAATGAGGG - Intergenic
1092036387 12:5338852-5338874 TCCAAAAAACAAAAAAATGAAGG + Intergenic
1093384515 12:18535562-18535584 TTCAATAAGGAGAATTATGATGG - Intronic
1095898447 12:47303939-47303961 TGAAAGAGACAGAATAATGAGGG - Intergenic
1096256882 12:50068069-50068091 TCCAAGAAGTTCAAGAATGAGGG - Intronic
1096463260 12:51834497-51834519 TCCAGGAAGCAGGATCCTGAGGG - Intergenic
1097372143 12:58797437-58797459 TCCAAGAAGCAAAAATAAGAAGG - Intronic
1097484543 12:60179115-60179137 TCAAACTAGCAGAATAAAGAAGG - Intergenic
1099248097 12:80217978-80218000 TCCATTAAGCAGAATGCTGATGG + Intronic
1099462145 12:82936802-82936824 CCCAAGAAGCTGAATATTAATGG - Intronic
1100011733 12:89961878-89961900 TCCAAGAAGGGGTATAAAGATGG - Intergenic
1100515520 12:95323642-95323664 TCCAAAAACCAGAAAAAGGAAGG - Intergenic
1100557827 12:95714623-95714645 CCTAAGAAGCAAAATAATGCTGG + Intronic
1102442162 12:112971691-112971713 TCCAAGAATGACAATAATGAGGG - Exonic
1102586204 12:113924696-113924718 TCCAAGAAGAAGAACAAAGCAGG - Exonic
1102614541 12:114141979-114142001 TCCAAGAAGCATGAGAATGAAGG - Intergenic
1103883239 12:124182622-124182644 TACTAGAAACAGAATAAAGAAGG - Intronic
1104577747 12:129983394-129983416 GCCAAGAAGCAGAACAAGGCTGG - Intergenic
1106150918 13:27100795-27100817 TCTAAAAAGAAGAATAATCAGGG + Intronic
1107717064 13:43210764-43210786 TAGAATAAGCAGAATATTGAAGG - Intergenic
1108533666 13:51349682-51349704 TCCTAAAAGCAGAATCAGGACGG - Intronic
1110077016 13:71258768-71258790 TTCAAGAAGCAGAAAAATAACGG - Intergenic
1110426183 13:75369959-75369981 TCCAAGGAGAAAAATAATGCAGG + Intronic
1110520731 13:76473053-76473075 TCCCAGAAGGAGAAGTATGAAGG + Intergenic
1111310828 13:86482684-86482706 GCCAAGAAGCAAAGTGATGATGG + Intergenic
1111988988 13:95096583-95096605 TGCAACAAGCATAATAATGATGG + Intronic
1112125797 13:96466462-96466484 TCGTAGAAGCAGAAAATTGAAGG - Intronic
1112902250 13:104372135-104372157 GCCAAGAAACAGCATTATGATGG - Intergenic
1113322201 13:109244984-109245006 TTAAAGAAGCAGAAGCATGATGG + Intergenic
1115896135 14:38089706-38089728 TGCAAGATGCAGAATAATTTAGG - Intergenic
1115946629 14:38668602-38668624 TCCAATAAGCCCAATAATGAGGG - Intergenic
1116228279 14:42181624-42181646 TCCAAAAGGCATAATAATAAAGG + Intergenic
1116964194 14:50997765-50997787 TTGAAGAAGCTGAAAAATGAAGG - Intronic
1117129242 14:52668032-52668054 TTCTAGAAGCAGTACAATGACGG + Intronic
1117895059 14:60475404-60475426 TACAAGAATCAAAATTATGATGG + Intronic
1118980453 14:70712045-70712067 ACCATCAAGCAGAATCATGAGGG + Intergenic
1119993444 14:79225917-79225939 ACAAAGAAGCAGAAGAATGCAGG - Intronic
1121166919 14:91810933-91810955 TCCCAGAAGCAGAAAAGAGAGGG + Intronic
1121606425 14:95243750-95243772 TCCAATAAGCAGAGTAATTCTGG - Intronic
1126288888 15:47048554-47048576 AAAAAAAAGCAGAATAATGAGGG + Intergenic
1127349649 15:58137757-58137779 TCCAAGAATCAGAAAGATGGAGG - Intronic
1128332464 15:66764764-66764786 TCAAAGAAGGACAAAAATGATGG - Intronic
1129772947 15:78214212-78214234 TCCAGGAAGCAGGAAAATGCTGG - Intronic
1130848052 15:87765906-87765928 ACCAAGAAGAATAAAAATGAGGG - Intergenic
1131649681 15:94385133-94385155 TCAAAGAAACAAAATAAAGAAGG - Intronic
1132077246 15:98832066-98832088 CCCAAGAAGCAGAGGAATGAAGG - Intronic
1132800483 16:1749812-1749834 TCCAGGGAGCAGAGTAATGTGGG + Intronic
1133482301 16:6183169-6183191 GCCATGAAGAAGAATAATAAAGG + Intronic
1133496939 16:6327631-6327653 TTCAAGAAACAGAATAGAGAGGG + Intronic
1135066928 16:19317905-19317927 TCCAAGAATCAGGAGAATGCTGG - Intronic
1137771900 16:51023238-51023260 TGCGAGAGGCAGAATAATAATGG - Intergenic
1137960358 16:52876423-52876445 CACCAGAAGCAGAAAAATGAGGG + Intergenic
1140037003 16:71378849-71378871 TCCAAGAAGCAGGCTAGAGAAGG + Intronic
1141827519 16:86491438-86491460 TCCCCGGAGCAGTATAATGAAGG - Intergenic
1142788732 17:2246256-2246278 TCCTAGAAGCAGTATATTCAGGG + Intronic
1151260935 17:72915433-72915455 ACCAGGAAGCAGAAGAGTGAGGG - Intronic
1152958917 18:65449-65471 TCAAATAAACAGAATAAAGAAGG + Intronic
1153498259 18:5722000-5722022 TCCAAGAGGCAGCAGAATGCGGG + Intergenic
1153604098 18:6814104-6814126 TGAAAGAAGAAGAATAAGGAAGG + Intronic
1153817774 18:8806133-8806155 TCCAAGAGGCAGAAAAGTGGGGG + Intronic
1154100121 18:11465000-11465022 CCCAAGAAACAGCATAATGATGG - Intergenic
1156165234 18:34411954-34411976 TCTAATATGCATAATAATGAAGG - Intergenic
1156341028 18:36210933-36210955 TCCAAGAAGAAGAATCACCAGGG + Intronic
1156708925 18:39918029-39918051 TGCAAGAAACATAATAATAATGG - Intergenic
1157315648 18:46587392-46587414 TCCCAGAAGCAAAATGATAAGGG + Intronic
1157408403 18:47443297-47443319 TCAAGGAATCAGAAGAATGATGG + Intergenic
1162228458 19:9244491-9244513 TTCAAAATGCAGAAGAATGAAGG + Intergenic
1164896940 19:31885189-31885211 TCCAAGAAGGAGAATTTAGAAGG + Intergenic
1167406914 19:49316712-49316734 TACAAGAACAAGAATGATGAAGG + Intronic
1167849108 19:52188650-52188672 TTCAAGTAGCAGAATAAAGGAGG + Intergenic
926396712 2:12450367-12450389 TCTATGCACCAGAATAATGAGGG - Intergenic
927128530 2:20036270-20036292 GGCAAGAAGCAGCATAGTGAGGG - Intronic
927587951 2:24326366-24326388 TGGAAGAAGCAGAATAAAGAAGG + Intronic
927969326 2:27295001-27295023 TACAAGAAATAGAATAATAATGG - Intronic
928160501 2:28919758-28919780 TCCAATTATCAGAATAGTGAGGG - Intronic
928197086 2:29223798-29223820 TCCAAGAAGCAGACTGGAGATGG + Intronic
929211646 2:39364212-39364234 TCCAGGAAGCAGAATGGTCATGG + Intronic
929396070 2:41523751-41523773 TTCAAGAGGCAGCATAAAGAGGG + Intergenic
929883912 2:45861762-45861784 TCAAAACAGCAGAATATTGAAGG + Intronic
930320460 2:49848199-49848221 TCCAATAAACTGAATAATCAGGG + Intergenic
931360463 2:61573535-61573557 TCCAAGAAGAAAAAGAATGCTGG - Intergenic
931858406 2:66328306-66328328 TTCTAAAAGCAAAATAATGAGGG + Intergenic
933479829 2:82841606-82841628 TACAAGAAGCAGCAACATGAAGG - Intergenic
933741165 2:85535306-85535328 TACAAAAAGCCTAATAATGAGGG + Intergenic
935277934 2:101491885-101491907 TCCAAGCAGCAAAATGTTGAAGG + Intergenic
935672196 2:105565412-105565434 TCAGAGAACCAGAAGAATGAGGG - Intergenic
935923898 2:108046281-108046303 TTCAAAAAGTAGAATAATGTTGG + Intergenic
936264135 2:110987710-110987732 TCTAAGAAACAAAATATTGAGGG - Intronic
936918659 2:117665192-117665214 TCTGAGAAGCACAAGAATGAGGG + Intergenic
937736089 2:125291992-125292014 TCCATGAAGCAGAAAAATATTGG + Intergenic
938586209 2:132693155-132693177 GCCAAGAAGCAGAAGATGGAAGG - Intronic
939563183 2:143755315-143755337 TCTAAGTAGTAGAATTATGAGGG + Intronic
941633466 2:167909448-167909470 TGCAGTAGGCAGAATAATGACGG - Intergenic
942608186 2:177713888-177713910 TCAAGAAAGGAGAATAATGAGGG - Intronic
943818636 2:192289886-192289908 TCCAAGAAGCAGATAAACAAAGG - Intergenic
944852809 2:203737049-203737071 TTCAAGAAACAGGAAAATGATGG - Exonic
945020570 2:205566994-205567016 TCCATGAAGCATAAGGATGAGGG + Intronic
946758247 2:222967855-222967877 ACTCAGAAACAGAATAATGAAGG - Intergenic
947942562 2:234071086-234071108 TCCAAGAAGATGAAGGATGAAGG - Intronic
1170296112 20:14827753-14827775 TCCAATACTCTGAATAATGAAGG - Intronic
1170978852 20:21192053-21192075 TCCAAGGAGCAGGATCAGGACGG + Intronic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171540785 20:25953590-25953612 AAAAAAAAGCAGAATAATGAGGG - Intergenic
1173457922 20:43218312-43218334 TCAAAGAAGCTGGATAAAGATGG - Intergenic
1175181850 20:57154064-57154086 TCCAACAGGCAGAATAGTGCGGG + Intergenic
1175428274 20:58884604-58884626 TCCAGGATGGAGAATAATGTAGG - Intronic
1176690785 21:9905655-9905677 TAGAAGAAACAGAATATTGAAGG + Intergenic
1177041111 21:16112641-16112663 CCCCAAAGGCAGAATAATGATGG - Intergenic
1177821483 21:26035265-26035287 TCCAAAAAACAGAATGATCAAGG + Intronic
1178666256 21:34549670-34549692 TCCAAGATGGAGGACAATGATGG + Intronic
1179020971 21:37640753-37640775 TGAAAAATGCAGAATAATGAGGG - Intronic
1180857556 22:19058003-19058025 TCCAAGAAGCAGAATAATGAAGG + Intronic
1182134465 22:27888339-27888361 TCCTAGAAGCAGAATTTTGCTGG + Intronic
949496808 3:4640179-4640201 TTCAAAAAGGAAAATAATGAAGG - Intronic
949535225 3:4989916-4989938 TCCAAGCAGGAGAAGAAGGAGGG + Intergenic
949591265 3:5496593-5496615 TCCAAGAAGCAGGTTAATTAAGG + Intergenic
950896185 3:16453527-16453549 CCCAAGAAGCTGACTATTGATGG - Intronic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
952204424 3:31165918-31165940 TCCAAGAGGCAGTAAATTGATGG - Intergenic
952773531 3:37023025-37023047 TCTAAGAAGCAGAAAGATGGTGG - Intronic
953244663 3:41179672-41179694 TCCAAGAAGGAGAAAGATGGAGG - Intergenic
954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG + Intronic
955088292 3:55724353-55724375 GCTAAAAAGCAGAATAAAGAAGG - Intronic
955169296 3:56547767-56547789 TCCAAGAAGCAAAGTAATACGGG - Intergenic
955503253 3:59605880-59605902 TCCTAGAAACAGAATAAAGATGG + Intergenic
955739130 3:62071215-62071237 TCCAAGAAAAAAAATCATGACGG - Intronic
956001196 3:64731702-64731724 TACATGAAGCAAAATAAAGAGGG - Intergenic
956044139 3:65177242-65177264 CCCAAGAAACACAATCATGATGG + Intergenic
957561556 3:81828471-81828493 TCTAAGAGGCAGAAAAACGAAGG - Intergenic
958112499 3:89166657-89166679 TCCAAGAAGCAAAAGAAAAAAGG - Intronic
961251214 3:125507349-125507371 TCCAAGGAACAGAAAAAAGATGG + Intronic
961526683 3:127505726-127505748 TCAAAGAAGGGGAATAATAAAGG + Intergenic
963649882 3:147965710-147965732 TAAAGGAAGCAGAATAAGGATGG - Intergenic
964322570 3:155513532-155513554 GACAAGAAGCAGAATCAAGATGG + Intronic
964874868 3:161355642-161355664 CCCTAGAAACAGAAAAATGATGG + Intronic
965006355 3:163031223-163031245 ACCAACAAGCAGAAAAAGGAGGG - Intergenic
965693540 3:171382719-171382741 TCCAAGTACCAGACTAATGGAGG - Intronic
965775474 3:172225770-172225792 GCCAAGATCCAGAATAAAGAAGG - Intronic
965962010 3:174440527-174440549 TCCATGAAACAGGATAATAAAGG - Intronic
966212000 3:177463270-177463292 TCCCATTAGCAGAGTAATGACGG - Intergenic
968128035 3:196174702-196174724 TTTATGAAGCAGAAAAATGAGGG + Intergenic
969169680 4:5350021-5350043 TCCCAGAAGGAGAATAGAGAAGG + Intronic
969930960 4:10630055-10630077 TGCAAGACTAAGAATAATGAAGG + Intronic
970134810 4:12910648-12910670 TCCAATAAGAAGAGAAATGAAGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
973179990 4:47255517-47255539 TCCTAGAAGAAGAATAAGTAAGG + Intronic
974062132 4:57044835-57044857 TCCAAGAAGCAGAACACTCTAGG + Intronic
975174525 4:71272337-71272359 TCCCAGAAGCCCAATAAGGAAGG + Intronic
975258686 4:72270658-72270680 ACCAAGAAGGAGAATACAGAAGG + Intergenic
975734829 4:77371072-77371094 TCAAAGAGGCAAAATACTGAGGG - Intronic
978538510 4:109789336-109789358 CCCAAGCAGGAGAATCATGAAGG + Intronic
978868543 4:113545795-113545817 TCCCAGAATCAGAATAAGAATGG + Intronic
979061936 4:116073735-116073757 TCCAAGAAGCAGATTATATATGG + Intergenic
980853315 4:138410307-138410329 TTGAATAATCAGAATAATGATGG + Intergenic
980939310 4:139258374-139258396 TTTAACAACCAGAATAATGAAGG - Intergenic
981536760 4:145808310-145808332 GCCAGGAAACAGGATAATGAGGG - Intronic
981537751 4:145817475-145817497 CTCAAGAAGCAGAATCATGGCGG + Intronic
981643205 4:146968386-146968408 AGCAAGAAGCAGAAGAATGCAGG + Intergenic
982857307 4:160400137-160400159 CCAAAGAAGCAGAATAATATTGG - Intergenic
983377171 4:166944967-166944989 TTCAAGCACCATAATAATGATGG - Intronic
983500811 4:168497310-168497332 TCCAAGCAAAAGAATAATTAAGG - Intronic
985234264 4:187855945-187855967 TCCAAGGAGAAAAATAATGCAGG + Intergenic
986045091 5:4028957-4028979 TCCAGGAATCAGAATAATTGAGG - Intergenic
986497121 5:8355364-8355386 TCCTAGAGGCAGACTTATGATGG + Intergenic
986767158 5:10938645-10938667 TCCCAGAGGCAAAGTAATGAAGG + Intergenic
987317123 5:16734155-16734177 TCCAAGAAGCAGCAGACAGAAGG + Intronic
988004563 5:25392261-25392283 TCGAAGAAGGATAAAAATGAAGG - Intergenic
989547488 5:42691378-42691400 TCCAAGAAGGATAAAACTGAGGG + Intronic
989792557 5:45423271-45423293 CTCAAGAAGCAGAATAGAGATGG + Intronic
990059189 5:51626382-51626404 TGCCAGAAGCAGTATAATAATGG - Intergenic
990256494 5:53976017-53976039 TCCAATAAACAGAACATTGATGG - Intronic
990967989 5:61470492-61470514 TCAAAAATGAAGAATAATGAGGG - Intronic
991320367 5:65366964-65366986 TCCAAGAAAAAGAATGATGCGGG + Intronic
991530116 5:67605444-67605466 TTCAAGAAGGTGGATAATGAGGG - Intergenic
991712374 5:69420185-69420207 GCCAAGAACCAGAATAATAATGG - Exonic
991989108 5:72320102-72320124 CCCAAAAAACAGAATAATCAGGG + Intronic
993904707 5:93610036-93610058 TCCAAGAAACCAAATAAAGAAGG + Intergenic
994346876 5:98697621-98697643 TCCAAGGGGCAGAACAGTGATGG - Intergenic
994980664 5:106872518-106872540 TTTAAGAGGGAGAATAATGATGG - Intergenic
996496651 5:124164698-124164720 TCCAATAAGGAGAATGATGTTGG + Intergenic
997011157 5:129879295-129879317 TCCAAATAGCAGAAAAATGTAGG + Intergenic
997302599 5:132816869-132816891 TGAAAGAGGCAGAAGAATGAAGG - Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999642623 5:153687124-153687146 TCCATGAAGCATAATAAGAAAGG - Intronic
999889905 5:155965993-155966015 TCAAAGAAGCAAATTCATGAAGG - Intronic
1000766114 5:165291932-165291954 TCCAAGAAGCAGAAAAACTGAGG + Intergenic
1000987752 5:167879507-167879529 TCCCAGCAGCAGCATAATGGAGG + Intronic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1003771661 6:9310704-9310726 TCCTAGAAGTAGAATTATGCTGG - Intergenic
1004270230 6:14188611-14188633 TCGTGGAAGCAGAATAATGTTGG - Intergenic
1004407992 6:15352471-15352493 TCCAGGAATCAGAATAGTGAAGG + Intronic
1004745140 6:18501980-18502002 TCTAAGAAGCAAAGAAATGAGGG - Intergenic
1004907079 6:20246209-20246231 TCCAAAAAGCAGGAAAATGTGGG + Intergenic
1005512742 6:26526036-26526058 TCCAAGAAGTGGACTAATAAAGG - Intergenic
1005941061 6:30560389-30560411 TCAAAGAAACAGTAGAATGATGG + Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1007636853 6:43304873-43304895 TCCTAGAAGCCAAATAATCAAGG - Exonic
1007958977 6:45941546-45941568 ACCAAGCAGCAGAACAATGCTGG - Exonic
1008456344 6:51715322-51715344 TTCAGGAAGAAGCATAATGAAGG - Intronic
1008845586 6:55959166-55959188 TCTAAGAAGATGAATAATAAAGG - Intergenic
1009399576 6:63238325-63238347 TCCACGCAGAACAATAATGATGG + Intergenic
1010140170 6:72605007-72605029 TCCAAGGAGCTGAATAAAGAGGG - Intergenic
1010302417 6:74277359-74277381 TCAAATAATCAGAATGATGAGGG + Intergenic
1010314688 6:74434091-74434113 ACCAAGAATAAGAAGAATGAGGG - Intergenic
1010335303 6:74674802-74674824 GCCAAAAAGCAGAAAAATAAAGG - Intergenic
1011435955 6:87336960-87336982 TCAGAGAAGCACAATTATGAAGG + Intronic
1012574511 6:100776011-100776033 TTAAAGAAGAAGAATAATGTGGG + Intronic
1012691425 6:102317757-102317779 TCAAAGAATCACAAAAATGATGG - Intergenic
1013365228 6:109432585-109432607 TCCTAGAATCAGAATATTGGGGG - Intronic
1013694182 6:112681843-112681865 TGCAAGAATCAGAATAAATATGG + Intergenic
1013796408 6:113894120-113894142 ACAAGGAAACAGAATAATGAGGG - Intergenic
1013856367 6:114578478-114578500 TTCAAGGAGCAGAGTAAAGAAGG + Intergenic
1014368382 6:120574115-120574137 ACCATGAAGCAGAATAAAAATGG - Intergenic
1014627447 6:123745107-123745129 TCCAAGCAGCATAATAATTTTGG + Intergenic
1015984188 6:138869323-138869345 CCCACAAAGCAGAATTATGATGG - Intronic
1016380885 6:143477831-143477853 TCCAAGAAGAAAAATGATTAAGG - Intronic
1017534256 6:155329636-155329658 TCCAAGCAGCAGGATCCTGATGG + Intergenic
1017783451 6:157734564-157734586 TCCAAAAAGCAGGAAAATGCAGG - Intronic
1020643513 7:10785913-10785935 TACAAGAAACAAAATAATTAAGG + Intergenic
1022069742 7:26901110-26901132 TCGAAGAAGCAAAGTTATGATGG + Intronic
1023053737 7:36275206-36275228 TCCAGGAAGCAGGATGAGGATGG + Intronic
1023946248 7:44805307-44805329 TCCAACCAGCAGAAAAATGATGG - Intronic
1024100748 7:46030324-46030346 TCCAGGACCAAGAATAATGATGG - Intergenic
1024170145 7:46777027-46777049 TACATGAAAAAGAATAATGAGGG + Intergenic
1024989925 7:55225138-55225160 AGCAAGATGCAGAATTATGATGG - Intronic
1025292209 7:57739839-57739861 AAAAAAAAGCAGAATAATGAGGG - Intergenic
1027424142 7:78045584-78045606 AAAAAGAAGCTGAATAATGATGG + Intronic
1027869365 7:83687214-83687236 TGCAAGAAGAAAAATAAGGAAGG + Intergenic
1028979155 7:96947710-96947732 GCTAAGAAGCATAATAATCAGGG - Intergenic
1032136441 7:129283244-129283266 TCCAAGGTGCAGTTTAATGAAGG - Intronic
1032305397 7:130729338-130729360 TACAAGAATCAGACTAATGAGGG + Intergenic
1032976330 7:137228048-137228070 TCTAAGAAGAAGAAAAAGGAAGG - Exonic
1033944588 7:146700197-146700219 TCCAACAACCAGAAAACTGAAGG - Intronic
1034129929 7:148706335-148706357 TCCAAGCAGCAGAAAGCTGAGGG - Intronic
1035122781 7:156582411-156582433 TCATAGAAGCAGAAGAATGGTGG - Intergenic
1037167000 8:15842551-15842573 TCCATGGAGCAAAATGATGAGGG + Intergenic
1037357148 8:18033129-18033151 TCCAAGATCCATTATAATGAAGG - Intergenic
1039406897 8:37320765-37320787 CCCAAGAAGAAGAATCATAAAGG + Intergenic
1041098623 8:54373896-54373918 ACCAAGACGCAGAAAAGTGAAGG - Intergenic
1046561207 8:115839748-115839770 GGCAAGAAGAAGACTAATGAAGG + Intergenic
1046811865 8:118541981-118542003 TTCAAGAATCAGAATATTGCTGG - Intronic
1047136908 8:122089684-122089706 TCCAAGGACCATAATAACGAAGG + Intergenic
1047516949 8:125563388-125563410 TCCAGGGAGCAGTATTATGAAGG - Intergenic
1047888025 8:129274451-129274473 CCCAAGAAGCAGAAAAAGGCAGG + Intergenic
1048076507 8:131077393-131077415 TCCAAGAAGTAGAAGAGTGAGGG + Intergenic
1048767413 8:137859999-137860021 TCCAAGGAGGAGAAAAATGGAGG + Intergenic
1049835194 8:144730759-144730781 TCCAAGAAGGAGGTTAGTGATGG - Intronic
1052330179 9:27259745-27259767 TCCAAGAAGACGAACAAGGAGGG - Intergenic
1052811114 9:33061279-33061301 GCCCAGCAGCATAATAATGATGG + Intronic
1053627517 9:39890171-39890193 TAGAAGAAACAGAATATTGAAGG + Intergenic
1053778476 9:41575849-41575871 TAGAAGAAACAGAATATTGAAGG - Intergenic
1054166438 9:61786093-61786115 TAGAAGAAACAGAATATTGAAGG - Intergenic
1054216370 9:62360532-62360554 TAGAAGAAACAGAATATTGAAGG - Intergenic
1054671111 9:67794811-67794833 TAGAAGAAACAGAATATTGAAGG + Intergenic
1055292596 9:74798638-74798660 TCCAAGTAGAAGAATACTGTAGG - Intronic
1056003929 9:82247213-82247235 TCCCAGAAGCCAAGTAATGATGG + Intergenic
1056936916 9:90922308-90922330 TCTAAGAAACAGAACAATGAAGG - Intergenic
1058270781 9:102968637-102968659 TCCAAAAATCAGAGAAATGAAGG - Intergenic
1058510103 9:105708802-105708824 TCTAAGAAGAAAAATAAAGAAGG - Intronic
1058842520 9:108923843-108923865 TGCAAGAAGCACAATAAAGATGG + Intronic
1058999950 9:110338002-110338024 GCCAAGAATCAGAAAACTGAGGG + Intergenic
1059296983 9:113279985-113280007 TCCAACAAGCTGGATGATGAAGG - Intronic
1059683443 9:116608946-116608968 TCCAAGACGAAAAATAATGCTGG + Intronic
1060092794 9:120758974-120758996 TCCAAAAAGCAAAACAATAAAGG - Exonic
1185907052 X:3944796-3944818 TGCAATAAGCAAAATCATGAAGG - Intergenic
1186579648 X:10803860-10803882 TACTAGAAGAAGAATAAAGAAGG - Intronic
1186958551 X:14709759-14709781 TCAAAGCAGCAGAGTAAGGAGGG - Intronic
1187355082 X:18561038-18561060 TCCAAGAAGAAGAAAATTAAGGG - Intronic
1187728833 X:22232831-22232853 TCCAGGTAGCAGCATAATGACGG - Intronic
1188312896 X:28639665-28639687 TCAAAGAAGCAGAATAAAAAAGG + Intronic
1188432841 X:30125685-30125707 TGGCAGAAACAGAATAATGAGGG + Intergenic
1189105674 X:38232914-38232936 TCAAAGAAGCAGAATCAGTAGGG - Intronic
1190976276 X:55404578-55404600 TCCCAGAAGAAGAATATAGAGGG - Intergenic
1193731115 X:85105060-85105082 TCAAAAAAGAAGAGTAATGAGGG - Intronic
1195742536 X:108079745-108079767 CACAAGAAGCAAAATAATGAAGG + Intergenic
1197287826 X:124616852-124616874 TCAAAGAAGAAAAAAAATGAAGG + Intronic
1197905429 X:131419861-131419883 TTGAAGAAGAAAAATAATGAAGG + Intergenic
1198382100 X:136093580-136093602 TCACAGAAGCAGAATAATCACGG - Intergenic
1200036810 X:153336315-153336337 TCGAAGTAGCAGAATCCTGAAGG - Intronic
1200830053 Y:7680498-7680520 GCCAAGAAGGAGAAAAAGGATGG - Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic
1201333175 Y:12849979-12850001 TCCAATCAGCAGAAAAAAGAGGG - Intronic