ID: 1180858099

View in Genome Browser
Species Human (GRCh38)
Location 22:19060784-19060806
Sequence CCCAGGCGGGGCTCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180858090_1180858099 -6 Left 1180858090 22:19060767-19060789 CCTGCAGGGTCTTGGCCCCCAGG 0: 1
1: 0
2: 3
3: 34
4: 328
Right 1180858099 22:19060784-19060806 CCCAGGCGGGGCTCACAGGCTGG 0: 1
1: 1
2: 0
3: 22
4: 334
1180858086_1180858099 9 Left 1180858086 22:19060752-19060774 CCTGGTGCTGTCAAACCTGCAGG 0: 1
1: 0
2: 3
3: 27
4: 320
Right 1180858099 22:19060784-19060806 CCCAGGCGGGGCTCACAGGCTGG 0: 1
1: 1
2: 0
3: 22
4: 334
1180858085_1180858099 25 Left 1180858085 22:19060736-19060758 CCAGGGCACATCATGACCTGGTG 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1180858099 22:19060784-19060806 CCCAGGCGGGGCTCACAGGCTGG 0: 1
1: 1
2: 0
3: 22
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180858099 Original CRISPR CCCAGGCGGGGCTCACAGGC TGG Intronic
900086794 1:902438-902460 CCTAGGCTGGGCTCCCAGACAGG + Intergenic
900199858 1:1399594-1399616 CCCGCTCGGGGCGCACAGGCAGG - Exonic
900255456 1:1695945-1695967 CCCAGGCTGGGCTCAAACTCAGG + Intronic
900264017 1:1748176-1748198 CCCAGGCTGGGCTCAAACTCAGG + Intergenic
900360210 1:2284685-2284707 GCCAGGGAGGGCTCATAGGCCGG - Intronic
900648623 1:3720332-3720354 CCAAGGTGGGGGTCGCAGGCAGG + Intronic
900715078 1:4138966-4138988 CTCAGGCTGGGCTCTCAGTCAGG - Intergenic
901425706 1:9181413-9181435 CCCACTGGCGGCTCACAGGCTGG + Intergenic
901642539 1:10700167-10700189 CCCGGGCTGGGGCCACAGGCTGG - Intronic
901923094 1:12549682-12549704 CCCAGCCGCGTCTCCCAGGCTGG - Intergenic
901953186 1:12764583-12764605 CTCAGGTGGGGCTGACAAGCTGG + Intergenic
903070386 1:20724259-20724281 ACCAAGAGGGGCCCACAGGCAGG + Intronic
903125797 1:21246865-21246887 CCCAGGCTGGTCTCAAACGCAGG + Intronic
903261026 1:22131984-22132006 CCCAGGCAGGGCTGAGAAGCCGG - Intronic
903383079 1:22910049-22910071 CCAAGAGGGGGCTCACAGGATGG + Intronic
903929144 1:26852421-26852443 CAGGGCCGGGGCTCACAGGCAGG + Intronic
904831685 1:33309657-33309679 CCCAGACGGGGGTCACGGCCAGG + Intronic
905411272 1:37770277-37770299 CCCAGGCTGGTCTCAAAGTCTGG + Intergenic
905626258 1:39492059-39492081 GCCGGGCGGGGGTCGCAGGCCGG - Exonic
905670638 1:39788396-39788418 GCCGGGCGGGGGTCGCAGGCCGG + Exonic
905879037 1:41451598-41451620 CCCAGGCTGGCCTCACTGGAAGG - Intergenic
907313789 1:53554748-53554770 CACAGCCGGGTCTGACAGGCTGG + Intronic
908496789 1:64702259-64702281 ACCAGGCAGTGCTTACAGGCTGG - Intergenic
910099223 1:83558902-83558924 ACCAGGCAGGGCTCACTGGTAGG + Intergenic
910412610 1:86963677-86963699 CCCAGACGGGGGTGACAGCCGGG + Intronic
912564894 1:110580510-110580532 TCCAAGCGGGGCTCCCAGGGAGG + Intergenic
913610142 1:120503022-120503044 GCCAGGGGGCGCTCACAGGTGGG - Intergenic
914581048 1:149019217-149019239 GCCAGGGGGCGCTCACAGGTGGG + Intronic
915129631 1:153687678-153687700 CCTGTGCGGGGCTCCCAGGCTGG + Exonic
915516813 1:156418227-156418249 CCCAGCCCCTGCTCACAGGCAGG + Intronic
915702926 1:157812804-157812826 CCCTGGCATGGGTCACAGGCAGG - Intronic
916179432 1:162070593-162070615 CCCAGGCTGAGCTCACTTGCCGG - Intronic
919105197 1:193140708-193140730 CCCAGGCAGGTGTCCCAGGCAGG + Intronic
920309948 1:205043135-205043157 CCCAGGCTCCGCTCACTGGCTGG - Intergenic
921893982 1:220380011-220380033 CCCAGGCTGTGCCCACAGACAGG - Intergenic
922239186 1:223744387-223744409 CCCAGCCGGGTCTCACATCCTGG - Intronic
922602996 1:226870962-226870984 CCCAGCCGGGGCTCGGCGGCAGG - Intronic
922720211 1:227896451-227896473 CCCGGGAGGGGCCCACAGTCAGG + Intergenic
922774393 1:228208136-228208158 CGCAGGCTGGGGGCACAGGCTGG - Exonic
1063160147 10:3412930-3412952 CCCAGGCTGGGGGCAGAGGCCGG - Intergenic
1064869063 10:19917237-19917259 CCAAGGCTGGGCACAGAGGCAGG + Intronic
1065784907 10:29204024-29204046 CCCAGGCGGGGCCCTCACCCTGG - Intergenic
1067088025 10:43253080-43253102 CCCAGGGAGGGCCCACAGGCGGG + Intronic
1067847930 10:49737911-49737933 CCAGGGCAGGGGTCACAGGCAGG - Intronic
1070505127 10:77106439-77106461 CCCAGATGGGGCTCTCAGCCCGG - Intronic
1070673873 10:78398617-78398639 CACAGCGAGGGCTCACAGGCTGG - Intergenic
1075573004 10:123558933-123558955 CCCAGGCGGCGCCCAAAGCCTGG + Intergenic
1075677092 10:124303354-124303376 CCCACGTGGGGCTCTCAGTCAGG - Intergenic
1075780943 10:125016695-125016717 CCCAGGCCCAGCTCACAGCCAGG + Intronic
1075817436 10:125275572-125275594 CCCAGGCTGGGCCTCCAGGCTGG + Intergenic
1076426822 10:130372926-130372948 CCCAGGCAGGGCTGGCAGGTTGG + Intergenic
1076523840 10:131098150-131098172 GCCAGGCTGGTCTCACTGGCAGG + Intronic
1076851083 10:133093466-133093488 CGCACGCCGGGCTCACACGCTGG + Intronic
1077058148 11:605919-605941 CCCAGTCCACGCTCACAGGCAGG - Intronic
1077247826 11:1547828-1547850 CCCAGCGGGCGCTCACAAGCTGG - Intergenic
1077338428 11:2015641-2015663 CACGGGCGGGGCTTACAGACAGG - Intergenic
1083282511 11:61635911-61635933 TCCAGATGGGGCTCCCAGGCTGG - Intergenic
1083670631 11:64298105-64298127 CCCAGGCGCGGACCCCAGGCAGG + Exonic
1083879407 11:65540701-65540723 CCCGGGCGGGGCCTACAGGAGGG + Intronic
1084537158 11:69764013-69764035 CCCAGGAGAGGCTCCCATGCTGG + Intergenic
1085532943 11:77202519-77202541 CCCAGGCCCTGCTCACAGGTGGG - Intronic
1085665384 11:78410938-78410960 CCCAGGCTGGTCTCACACTCCGG - Intronic
1085704432 11:78773508-78773530 CTCAGGTGGGGCTCACAGAAAGG + Intronic
1088849337 11:113692523-113692545 TCCAGCCTGGGCTCACGGGCAGG + Intronic
1090583042 11:128180879-128180901 CCCAGGCCTGGGTCACAGGGTGG + Intergenic
1091266802 11:134277186-134277208 CACAGGCGGGTCTTCCAGGCGGG - Intronic
1091309273 11:134561181-134561203 CCCAGGCACAGCTCTCAGGCCGG + Intergenic
1202821412 11_KI270721v1_random:70823-70845 CACGGGCGGGGCTTACAGACAGG - Intergenic
1092024843 12:5231904-5231926 ACCAGGCAGGGCTCACAGGAGGG - Intergenic
1093414042 12:18899758-18899780 CCCAGGCGGGTCTCAAACTCCGG - Intergenic
1093498189 12:19780671-19780693 CCCAACCAGGGCTCTCAGGCTGG - Intergenic
1096114852 12:49049905-49049927 CCCAGGAGGGGCTCTGAGCCAGG + Exonic
1097177119 12:57149662-57149684 CACAGGCTGGAATCACAGGCAGG + Intronic
1097284208 12:57865274-57865296 CCCAGGCCGGGCCCCCAGCCCGG - Intergenic
1100215702 12:92445923-92445945 ACCAGGCGGGGAACTCAGGCAGG + Intergenic
1102031610 12:109743202-109743224 CCCATTGGGGCCTCACAGGCAGG + Intronic
1102656261 12:114484857-114484879 CCCAGACGGGGCTGCCGGGCGGG + Intergenic
1103984856 12:124760443-124760465 GGCAGCCTGGGCTCACAGGCTGG + Intergenic
1104108914 12:125688027-125688049 CCCCCGCGGTGCTCACTGGCTGG + Intergenic
1104284767 12:127414866-127414888 CACAGGTGCGGCTCACAGCCAGG - Intergenic
1104911876 12:132243670-132243692 GCCAGGTGGGGCTCACAGTTGGG - Intronic
1105889780 13:24674282-24674304 CCCAGGCCGGAGTCTCAGGCTGG + Intergenic
1106720004 13:32427543-32427565 CCCAGGCGGGGCACGGCGGCGGG + Intronic
1111572776 13:90108384-90108406 CCCAGGCAGGTCACCCAGGCAGG - Intergenic
1113382711 13:109818416-109818438 CCCAGGATGGGCTCAAAGGGTGG - Intergenic
1113407757 13:110057234-110057256 CCCAGGCTGGGCTCACAGGCTGG - Intergenic
1113465102 13:110507265-110507287 TGGAGGCGGGGCGCACAGGCAGG - Intronic
1113839390 13:113350161-113350183 CCCAGGCAGGACACACAGGCTGG + Intronic
1113903095 13:113807224-113807246 CCTCCGTGGGGCTCACAGGCAGG - Intronic
1116871629 14:50073915-50073937 CCCGGGCGGCGCTCGCCGGCGGG - Intergenic
1119420208 14:74503733-74503755 CCCAGGAGGGCCTTCCAGGCTGG - Intronic
1119725379 14:76919068-76919090 CCCAGGCGTGGCGGCCAGGCCGG - Intergenic
1122009789 14:98736687-98736709 CACAGGTGGGGCTCAGAAGCTGG - Intergenic
1122251405 14:100442360-100442382 CCCTGGGGGAGCTCCCAGGCTGG + Intronic
1122693645 14:103542781-103542803 CCCAGGCGGGGCACAGAGCGGGG - Intergenic
1122814853 14:104307358-104307380 CCCAGGAGAGGCCCCCAGGCTGG - Intergenic
1122886902 14:104714250-104714272 TCAAGGCCGGGCTCAGAGGCGGG - Exonic
1123028768 14:105440833-105440855 TCCAGGCGGGGCTTCCAGGTGGG + Intronic
1123029576 14:105445338-105445360 CCCAGGAGGGGCTCCAAGGCCGG - Intronic
1124354369 15:28984153-28984175 CCCTGGAGGGGCTCACAGTGGGG + Intronic
1124651004 15:31473901-31473923 CCCAGGAGGAGCTCAGAGTCTGG - Intergenic
1124959031 15:34381666-34381688 CCCAGGCGGGGTGAGCAGGCAGG - Intronic
1124975657 15:34527887-34527909 CCCAGGCGGGGTGAGCAGGCAGG - Intronic
1125476886 15:40053814-40053836 CCCTGGAGGAGCTCACAGGCTGG - Intergenic
1127840679 15:62828882-62828904 CCCTGGAGGGGATCACAGGCTGG + Intronic
1129479468 15:75811536-75811558 TCCAGGCGGGTATCACATGCTGG + Intergenic
1129510225 15:76116172-76116194 CCCATGCCAGGCTCCCAGGCTGG - Intronic
1131392342 15:92059533-92059555 GCCAGCCGCTGCTCACAGGCGGG - Intronic
1131445063 15:92491942-92491964 CCGAGGCTAGGCTCAGAGGCAGG - Intronic
1132221374 15:100108067-100108089 CCCAGGTGGGGCTCCTAGCCTGG - Intronic
1132770672 16:1561031-1561053 CCCCTGTGGGGCTCACAGGCCGG + Intronic
1132864630 16:2087334-2087356 CCCAGGCAGGGCAGATAGGCTGG + Intronic
1132956971 16:2599455-2599477 CCCAGGCAGGAACCACAGGCAGG - Exonic
1132969322 16:2677908-2677930 CCCAGGCAGGAACCACAGGCAGG - Intergenic
1133866418 16:9648035-9648057 CCCAGGTGGGGATCCCTGGCTGG + Intergenic
1134008649 16:10835067-10835089 CCAAGGAGGGGCTCACACCCTGG + Intergenic
1134079616 16:11315911-11315933 CCCAGCCGGGACCCACATGCTGG - Intronic
1136275268 16:29176142-29176164 CCCAGCCGGGTCTCGCAGGAAGG - Intergenic
1137001748 16:35235251-35235273 CCCAGGTGGCCCTCACAGGTGGG + Intergenic
1137789585 16:51163853-51163875 CCCATGTGGGGCTGACAGTCTGG - Intergenic
1138407644 16:56810600-56810622 CCCAGGCTGGGTGTACAGGCTGG - Intronic
1139322015 16:66122532-66122554 CCCAGGGGGGTCTCTCAGGAGGG + Intergenic
1139340935 16:66267472-66267494 CCCAGATGGGGCTGACCGGCCGG - Intergenic
1139341632 16:66271373-66271395 CCCAGACTGGGCTCACACACAGG + Intergenic
1139471084 16:67178552-67178574 CCAGGGCTGGGCTCGCAGGCGGG - Intronic
1140221867 16:73049291-73049313 CCCAGGCTGGCCTTACAGCCTGG + Intronic
1141285499 16:82668097-82668119 CCCAGGCAGGTCTCCCTGGCAGG - Intronic
1141461491 16:84180863-84180885 CACAGTCGGTGCTAACAGGCAGG - Intronic
1141946230 16:87311562-87311584 CCCTGGCGGAGCACACAGGTTGG + Intronic
1141986271 16:87582451-87582473 GCCAGGAGGGACCCACAGGCCGG - Intergenic
1142284072 16:89164542-89164564 TCCAGGCCTGGCCCACAGGCAGG - Intergenic
1142308862 16:89300451-89300473 GCCAGGCTGTGCTCGCAGGCGGG - Intronic
1142417420 16:89949992-89950014 CCCAGGCCTGGCGCACGGGCAGG - Intronic
1142477831 17:200167-200189 CCCAGGCTGGGCCCACAGCCAGG - Intergenic
1143116617 17:4584930-4584952 CCCAGGCGGGGCGCGCGGTCGGG - Exonic
1143786503 17:9259743-9259765 CACAGGACGGGGTCACAGGCAGG + Intronic
1145764191 17:27446981-27447003 CTCATGCAGGGCTCAGAGGCTGG + Intergenic
1147310887 17:39595661-39595683 CCAGGGCTGGGCTCACAAGCTGG + Intergenic
1147911211 17:43857349-43857371 CCCATGGGGGACTCACAGGTGGG + Intronic
1148688904 17:49515531-49515553 GCCAGGCGGGGCTCGAAGCCAGG - Intergenic
1149657495 17:58318066-58318088 CCCAGGTGGGGCTTGCAGGCAGG + Intronic
1151766931 17:76137598-76137620 GTGAGGCGGGGCTCAGAGGCGGG + Exonic
1151963405 17:77419207-77419229 CCCAGGCGGGTCACACTTGCAGG + Intronic
1152175021 17:78781936-78781958 CTGGGGCGGGGGTCACAGGCCGG - Intronic
1152584116 17:81181528-81181550 ACCAGGCGGGGCTCACGGAGGGG - Intergenic
1152677072 17:81647114-81647136 CCCAGCAGTGGCTAACAGGCGGG + Intronic
1152749764 17:82057247-82057269 CCCAGGGAGGGCACACAGGCTGG - Exonic
1152800011 17:82326567-82326589 CCCAGGCTGGACGCCCAGGCTGG - Intronic
1152848187 17:82615335-82615357 CACAGGCTGGGCTCACACGAGGG + Exonic
1154151362 18:11908793-11908815 CCGTTGCGGGGCGCACAGGCGGG + Exonic
1154322950 18:13369144-13369166 CTGAGGCCGGGCTCACAGGCAGG + Intronic
1155928615 18:31684448-31684470 CCCAGGCTGCGCTCTCAGGCCGG + Exonic
1156463938 18:37336898-37336920 CCCCGGCGGGGCTGCCGGGCTGG + Intronic
1156822842 18:41393492-41393514 CCCAGGCTGGACGCCCAGGCTGG + Intergenic
1160784079 19:891725-891747 CCGAGGCGGGGCTGACTGACAGG + Intronic
1160820658 19:1056201-1056223 CACAGCCTGGGCTCACAGCCTGG + Exonic
1160863916 19:1249046-1249068 TCCGGGCGGCGCTCCCAGGCGGG + Intronic
1161210288 19:3062231-3062253 CCGAGCCGGGGCGCACAGCCGGG - Intronic
1161839266 19:6669073-6669095 CCCAGGTGAGGCACACAGACAGG + Intronic
1161869157 19:6857140-6857162 CCCACGCCGGGCTCAGAGCCTGG - Intronic
1162679935 19:12333233-12333255 CCCAGACAGGGCTCCGAGGCCGG + Intronic
1162780743 19:13005938-13005960 CCCAGCCGGAGCTCAAATGCTGG + Intronic
1163015477 19:14451613-14451635 TCCAGGAGGGGCTCAGATGCGGG - Intronic
1163529530 19:17841671-17841693 ACCAGGCGGTGCTCTCCGGCCGG + Exonic
1165068040 19:33240397-33240419 CCCAGGCTGTGCTCAAAGCCCGG - Intergenic
1165096612 19:33413209-33413231 CCCAGCCTGAGCTCACAGCCCGG + Intronic
1165781055 19:38434588-38434610 CCCAGCTGGGGCTCAGATGCAGG - Intronic
1167463747 19:49639664-49639686 CCCAGGAGGTGCTCAAAGCCAGG + Intronic
1168048880 19:53813902-53813924 CCCAGGCTGGTCTCAGAGCCTGG + Intronic
1168287834 19:55343187-55343209 CCCCTGCGGGGTTCACAGTCTGG + Intronic
1168708375 19:58482587-58482609 CCCAGGAGGGGCTCCCTGGGAGG + Intronic
925240740 2:2324667-2324689 CACAGGCGGGACTCGCAGCCCGG - Intronic
926295276 2:11564468-11564490 CCCAGGCTGGCCTCAAAGTCTGG - Intronic
927091874 2:19718736-19718758 CCAAGGTGGGGCTCACAGGATGG - Intergenic
927680037 2:25132987-25133009 ACCAGGCGGTGGACACAGGCAGG + Exonic
927863242 2:26573522-26573544 CCCAGGAGTGGCGCCCAGGCCGG + Intronic
927917475 2:26946233-26946255 CCCAGTCTTGGCTCTCAGGCAGG - Intronic
928025498 2:27735771-27735793 CCCCGGCGGGGCTCTCGGGAAGG + Intergenic
928206834 2:29290498-29290520 CCTAGGAGGGGCAGACAGGCAGG + Intronic
932435163 2:71699074-71699096 CCCAGGCTGGGCACACAGCGGGG + Intergenic
932573172 2:72948876-72948898 CCCAGGCTGGGCACACAGAGGGG + Intronic
932892646 2:75610193-75610215 CCCAGGCTGTGCTCTTAGGCAGG - Intergenic
934557582 2:95295606-95295628 CCCAGGCTGGTCTCAAAGTCTGG - Intergenic
934560475 2:95310602-95310624 CCCAGGCTGGGGTCCCAGGCTGG - Intronic
934574590 2:95392020-95392042 CCCTGGCAGGGCTCCCAGGGAGG + Intergenic
934751936 2:96799344-96799366 GGCAGGCGGGGCTCAAGGGCAGG - Intronic
935562657 2:104574927-104574949 CCCATGCGGGGCTGACAGACAGG + Intergenic
938102135 2:128504483-128504505 CCCAGCCGGGGCCTTCAGGCTGG + Intergenic
938115835 2:128602497-128602519 CACATGCGGAGCTCACAGCCAGG - Intergenic
938262762 2:129907051-129907073 CGCAGGAGGGGCCCGCAGGCTGG + Intergenic
938457496 2:131476096-131476118 CCCGTGCGGCGCGCACAGGCAGG + Exonic
946020527 2:216636897-216636919 CCCAGGGCGGGCAGACAGGCAGG + Intronic
947429192 2:230010769-230010791 CCCTGGCGGAGGACACAGGCTGG + Exonic
947594021 2:231399707-231399729 CCCAGGCCTGGCTCCCTGGCTGG + Exonic
947872586 2:233447694-233447716 TCCAGATGGGGCTCACAGCCAGG + Intronic
948021742 2:234738830-234738852 CTCAGAGGGGGCTCACTGGCAGG - Intergenic
948492313 2:238321073-238321095 TACAGGCCGGGCTCCCAGGCAGG - Intronic
948918688 2:241051551-241051573 CTGGGGTGGGGCTCACAGGCTGG - Intronic
948937681 2:241178173-241178195 CCCAGGCCAGGCACACATGCTGG - Intronic
1169273423 20:4217621-4217643 CAGAGGCGCGGCTCAGAGGCAGG + Intergenic
1169500655 20:6157721-6157743 CCCAAGGGAGGCTCACAGCCAGG - Intergenic
1171223206 20:23420488-23420510 CCCCGGCGGGGCCCACCTGCAGG + Intronic
1171481917 20:25460791-25460813 CTCAGCCGAGCCTCACAGGCAGG + Intronic
1172013758 20:31861309-31861331 CCCAGGACGGGCCCAGAGGCTGG - Exonic
1172484509 20:35290327-35290349 CCCAGGCAGGGCCGAGAGGCAGG + Intronic
1173534828 20:43801464-43801486 CCCAGGCCTGGCTCTCAGGAGGG - Intergenic
1173572392 20:44085839-44085861 CCCAGGTGGGGGTCAGAAGCTGG + Intergenic
1173825888 20:46047412-46047434 CCCTGCTGGGGCTCAGAGGCTGG + Intronic
1173826435 20:46050747-46050769 CCCTCGAGGTGCTCACAGGCTGG + Intronic
1174301844 20:49588158-49588180 CCCAGGCATGGCTCCCAGACTGG - Intergenic
1175186028 20:57180106-57180128 CCGAGGGGGTGCTCAGAGGCCGG - Intronic
1175252298 20:57616859-57616881 CCCAGGCAGGCGTCCCAGGCAGG - Intronic
1175389792 20:58619666-58619688 CCCCCTCGGGGCTCACAGTCTGG + Intergenic
1175568232 20:59997978-59998000 CCCAGGAAGGGCTCACAGGAGGG - Intronic
1175745277 20:61452183-61452205 CCCAGGCCGGGCCCACAAACAGG + Intronic
1175818325 20:61895363-61895385 CCCAAGCGGGTCCCACACGCAGG - Intronic
1175950640 20:62581428-62581450 CCCAGGGGGTGCGCGCAGGCTGG - Intergenic
1176093208 20:63328108-63328130 CACAGGCCTGGCTCACAAGCTGG - Exonic
1176109398 20:63404595-63404617 CCATAGCGGGGCCCACAGGCAGG - Intergenic
1180632124 22:17236961-17236983 CCCAGGCTGGGTTCAGGGGCTGG - Intergenic
1180675728 22:17585048-17585070 CCCAGGCTGGGCTCAAACTCTGG - Intronic
1180858099 22:19060784-19060806 CCCAGGCGGGGCTCACAGGCTGG + Intronic
1181035963 22:20169834-20169856 CACAGGCAGGGCTGACAGGGCGG - Intergenic
1181043087 22:20202078-20202100 CGCAGGTGGGGCTCAGAAGCTGG - Intergenic
1181068937 22:20320585-20320607 CGCAGTCTGGGCTCACGGGCTGG - Intergenic
1181082390 22:20424047-20424069 AGCAGGCGGGGCTGGCAGGCAGG + Intergenic
1181459003 22:23075271-23075293 CCAAGGTGAAGCTCACAGGCTGG - Intronic
1181696179 22:24593918-24593940 CCCAGGCTGGGGTCAGAGGTGGG - Intronic
1181803278 22:25360692-25360714 GCCTGGGGGGGCTCCCAGGCAGG + Exonic
1183477861 22:38045990-38046012 CCCTCGAGGGACTCACAGGCTGG - Intergenic
1183994343 22:41621546-41621568 CGCAGGCGGGCCTCAAACGCAGG - Exonic
1184124155 22:42475242-42475264 CCCAGGTGAGGCTCAGAGGGAGG - Intergenic
1184368510 22:44068026-44068048 TCCAGGCGGGGCTCTGGGGCAGG - Intronic
1184728967 22:46362873-46362895 CCCAGACTGGGCCCAGAGGCTGG - Exonic
1184794262 22:46722525-46722547 CCCAGGTGGGGCACACCGGAGGG - Intronic
1185314189 22:50171669-50171691 CCCCGCAGAGGCTCACAGGCAGG - Intronic
1185318700 22:50190423-50190445 CCTAGGCCGGCCTCAGAGGCGGG + Intronic
949341808 3:3038529-3038551 CCCAGGCAGAGCTTACAAGCTGG - Intronic
950615567 3:14155190-14155212 CCCATGGGGGGCTGACAAGCAGG + Intronic
951629042 3:24698892-24698914 CCCAGCAGGGGCTGACAGACAGG - Intergenic
954249241 3:49355480-49355502 CCCAAGGGGGACTCAAAGGCTGG + Intergenic
954402801 3:50327913-50327935 CCCTGGCGGGGGGAACAGGCGGG - Intronic
954619218 3:51986191-51986213 CGCAGGCTGGCCCCACAGGCAGG - Intronic
956698014 3:71935116-71935138 AACAGGTGGGTCTCACAGGCAGG - Intergenic
961443346 3:126965916-126965938 CCCAGGCGGGGATCTAAGCCAGG + Intergenic
961494237 3:127279160-127279182 CTGAGGCTGGGCACACAGGCAGG + Intergenic
961724223 3:128915441-128915463 GCCAGGCCTGGCTCACAGCCAGG - Exonic
962250433 3:133832931-133832953 TCCAGGCTGGGCCCACAGTCAGG - Intronic
962478748 3:135780316-135780338 CTCATGAGGGGCTCACAGGGAGG - Intergenic
966517191 3:180830676-180830698 CCCAGGCTGGACTCCCAGGCTGG + Intronic
968074263 3:195807939-195807961 GCGTGGCGGGACTCACAGGCAGG + Intronic
968562751 4:1293603-1293625 CCCAGGTGGGGTTCACAGAGAGG - Intronic
968594144 4:1473754-1473776 GCCACCCAGGGCTCACAGGCAGG - Intergenic
968660935 4:1798395-1798417 GCCAAGTGGGTCTCACAGGCCGG - Intronic
968811509 4:2801514-2801536 CCCAGGCCGGGGTCTCTGGCCGG - Intronic
968879927 4:3293396-3293418 CCCGGGCGGGCCTCACAGCGCGG - Intronic
969858927 4:10020871-10020893 CACAGGCGGGCCACACAGGCAGG - Intronic
970254449 4:14153250-14153272 CACAGGCAGGGAACACAGGCAGG + Intergenic
970939949 4:21620291-21620313 CCCAGGCTGGTCTCACACTCTGG - Intronic
972408168 4:38766108-38766130 CCGAGGCTGGGAGCACAGGCGGG + Intergenic
974057284 4:56996874-56996896 CCCAGGCTGGTCTCACATCCCGG - Intronic
977682634 4:99812790-99812812 TGCAGGGTGGGCTCACAGGCTGG + Intergenic
979594099 4:122514126-122514148 CCCAGGCTGGGCTCAAACTCCGG - Intergenic
983939153 4:173523245-173523267 CCTGGGTGGGACTCACAGGCAGG + Intergenic
984128562 4:175843580-175843602 CCCAGGCGAGCTTCATAGGCAGG + Intronic
985530339 5:430370-430392 CCCAGAGGGGGCTCAGTGGCGGG - Intronic
985755133 5:1709354-1709376 CCCAGGCACGGCCCACAGCCTGG + Intergenic
985757992 5:1730554-1730576 AGCAGGCGGGGGTCAGAGGCAGG + Intergenic
985816703 5:2132835-2132857 CACAGGCAAGGCTCAGAGGCGGG - Intergenic
985904445 5:2822739-2822761 CCCAGGAGGGGCACAGAGTCAGG - Intergenic
987235314 5:15936389-15936411 CCCAGGCGTGGCTCCCCTGCTGG + Intronic
990533467 5:56696944-56696966 CTCAGCAGGGGCTCTCAGGCTGG + Intergenic
992561598 5:77958034-77958056 CCCAGGCCGGGCGCACGGGGAGG + Intergenic
995707376 5:114999363-114999385 TGCATGCGGTGCTCACAGGCCGG + Intergenic
996607191 5:125337241-125337263 CCCAGGCGGTGCTGAGGGGCTGG - Intergenic
998380877 5:141724519-141724541 CCAAGGCTGCTCTCACAGGCTGG + Intergenic
998861444 5:146447692-146447714 CTGAGGCGGGGCCCAAAGGCGGG - Intronic
998903351 5:146878410-146878432 CCCCGGAGGCGCTCACAAGCGGG + Intronic
999222118 5:149988979-149989001 CCTAGGTGCTGCTCACAGGCAGG - Intronic
1000341576 5:160280876-160280898 CCCAGGCGGGGCTGCCATCCTGG - Intronic
1001514742 5:172347455-172347477 CCCAGGCTGTTCTCACAGGGAGG - Intronic
1001950595 5:175814170-175814192 CCCATGCTGGGCCCAGAGGCAGG + Intronic
1002635984 5:180609072-180609094 CTCAGGCGGGACCCACAGCCTGG - Intronic
1003315068 6:5004303-5004325 CCGAGGCGGGGCCCACAGAGAGG - Intergenic
1006060106 6:31412988-31413010 CACAGGCAGGGCCCCCAGGCTGG - Intronic
1006729704 6:36227726-36227748 CCCAGGAGGGACAGACAGGCTGG + Intronic
1008520977 6:52362243-52362265 CCGCGGCGGGACTCACCGGCAGG - Exonic
1012386481 6:98689146-98689168 CCCAGGCGGGGGGCAAAGGAAGG - Intergenic
1013256824 6:108395871-108395893 CCCAGGCTGGTCACCCAGGCTGG + Intronic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013403369 6:109820078-109820100 ATCAGGCAGGGCTCCCAGGCAGG + Intronic
1013538911 6:111088119-111088141 CCCACGCGGGTCGCCCAGGCTGG - Intronic
1014416336 6:121189788-121189810 CCCAGGGAGGGCTCACAGTATGG - Intronic
1016414735 6:143820616-143820638 CCCAGGCTGATCTCACAGGCTGG + Intronic
1017073768 6:150599972-150599994 CCCGGGCGGCGCTCGCAGGTCGG - Exonic
1017130340 6:151103079-151103101 CCCAGGCTGGTCTCAAAGTCCGG + Intergenic
1017648623 6:156561874-156561896 CCCAGGAGTGGCTCAGAGTCAGG - Intergenic
1018144915 6:160877075-160877097 CCTAGGAGGGGCTGGCAGGCAGG - Intergenic
1019511362 7:1419253-1419275 GCCAGGCTGGGCGTACAGGCAGG - Intergenic
1019578844 7:1750273-1750295 CCCCCGGGGAGCTCACAGGCTGG + Intergenic
1019731011 7:2629691-2629713 CCCTGGCAGGGCTGCCAGGCTGG + Intergenic
1022241596 7:28517623-28517645 GCCAGGTGGGGCTTACAAGCCGG + Intronic
1023080362 7:36521033-36521055 CTCAGCCAGTGCTCACAGGCAGG - Intronic
1024084998 7:45885350-45885372 CCCTGGCAGGGGTCACAGCCTGG - Intergenic
1024301927 7:47893460-47893482 CCCTGGCTGAGCCCACAGGCGGG + Intronic
1026930420 7:74220370-74220392 CCCAGGAGAGACACACAGGCTGG + Intronic
1027125522 7:75554123-75554145 CTCAGGTGGGGCTCTGAGGCAGG + Exonic
1029308370 7:99638859-99638881 CCCAGGCAGGCCGCAAAGGCTGG - Intergenic
1029548184 7:101222334-101222356 CCAGGCCGGGGCTCACTGGCTGG + Intronic
1032080521 7:128856366-128856388 CCCAGGCTGGGCTGGCAGGCAGG + Intronic
1032091583 7:128914184-128914206 CCCAGGCTGGGCTGGCAGGCAGG - Intergenic
1032417172 7:131744661-131744683 CCCAGGCTGGGCTCTGAGGAGGG + Intergenic
1033265620 7:139884205-139884227 CCCAGCCTGGGCCCACAGTCAGG - Intronic
1033981497 7:147170835-147170857 CCTGGGAGGGGCTGACAGGCAGG + Intronic
1034338782 7:150339624-150339646 CCCAGGCCGTGCTCACAGAGCGG + Intronic
1035019830 7:155794338-155794360 CCCACGCTGGGGCCACAGGCAGG - Intergenic
1035203959 7:157282564-157282586 CGCAGGTGGGGCTGACAGGTGGG - Intergenic
1035238116 7:157513374-157513396 CCAAGGGCGAGCTCACAGGCAGG - Intergenic
1035471519 7:159112792-159112814 CACAGTCGGGGCTCTCAGCCGGG - Intronic
1036760711 8:11506829-11506851 CCCAGGTGGGACTCTCAGGGAGG + Intronic
1037763405 8:21756911-21756933 CCCTGGTGGGTCTCCCAGGCTGG + Intronic
1038404102 8:27309149-27309171 CCCAGGCAGAGCCCCCAGGCTGG - Intronic
1038411407 8:27362289-27362311 CCTGGGCGTGACTCACAGGCAGG + Intronic
1042048800 8:64685155-64685177 CCCGGGCGGCGCTCGCCGGCGGG - Intronic
1046584974 8:116140122-116140144 CCCAGGGGGGGCTCTGGGGCAGG + Intergenic
1047251041 8:123182391-123182413 CCCAGGAGGGGAGCAGAGGCAGG + Exonic
1047957080 8:129984323-129984345 CCCAGGCAGGGCTGGCAGGGAGG + Intronic
1049258015 8:141624235-141624257 CCCAGACAGGGCTCACAGCTGGG + Intergenic
1049404085 8:142443909-142443931 CCAAGGTGGGGTTCCCAGGCAGG - Intergenic
1049430139 8:142558843-142558865 CCCAGGCAGGGCTTTCAGGAGGG - Intergenic
1049475315 8:142794496-142794518 CCCAGTCAGGGCCCAGAGGCAGG - Intergenic
1049562260 8:143317650-143317672 CCCAGACCGGGCTCCCCGGCTGG - Intronic
1049779678 8:144423221-144423243 GCCAGGCTGGGCTCAGAGGCGGG - Intergenic
1051721255 9:20039628-20039650 CCCAGGGGTGGCTCACTGTCAGG + Intergenic
1053200162 9:36146867-36146889 CCCAGGCGGGCGTTACATGCCGG + Intronic
1057186877 9:93062064-93062086 GCCCGGCTGGCCTCACAGGCTGG + Intronic
1060952610 9:127613133-127613155 CCCAGGTGGGTCTCGCAGCCAGG - Intronic
1061606426 9:131714421-131714443 CAGAGGCTGGGCTCTCAGGCGGG + Intronic
1061660426 9:132126492-132126514 CCTAAGAGGGGGTCACAGGCAGG - Intergenic
1061799971 9:133108532-133108554 CACAGGCAGGGACCACAGGCAGG - Intronic
1061971979 9:134049948-134049970 CCCATGTGGAGCCCACAGGCGGG + Intronic
1062001127 9:134216294-134216316 CCCAGGAAGGGCTCTCAGGATGG + Intergenic
1062139905 9:134950259-134950281 CAGAGGCGGGGCTCAGATGCTGG - Intergenic
1062208075 9:135348243-135348265 CCGGGGCGGGGCTCACACACTGG - Intergenic
1062329089 9:136028969-136028991 CCGAGGTGGGGCTAACAGCCTGG + Intronic
1062518833 9:136949388-136949410 CACAGGCAGGGCCGACAGGCAGG + Intronic
1062523802 9:136970290-136970312 CCCAGGCAGGGGTTCCAGGCTGG - Intronic
1062568536 9:137173918-137173940 ACCAGGCGCAGCTCACAGCCTGG + Intergenic
1185612664 X:1401894-1401916 CCCAGGAGGGCCTCACGGGGTGG + Intergenic
1187055431 X:15738021-15738043 CCCAGGGGGAGCGCAGAGGCGGG + Intronic
1190420629 X:50281093-50281115 ACCAGGCTGGGCTGACACGCAGG - Intronic
1191150177 X:57212025-57212047 CCCAGGCCGGTCTCACACTCTGG - Intergenic
1191849650 X:65576780-65576802 GCCAGGCTGGTCTCCCAGGCTGG + Intergenic
1194469133 X:94270984-94271006 CACAGGGTGGGCTGACAGGCTGG - Intergenic
1195052138 X:101106850-101106872 CCCAGGCTGGTCTCACATCCTGG - Intronic
1197891605 X:131275249-131275271 ACCAGGCTGGGCTAATAGGCTGG + Exonic
1199972134 X:152868970-152868992 CCCATGCGGGTCGCACTGGCTGG + Exonic
1200100005 X:153685595-153685617 TCCACGCGGGGCCCACAGCCTGG - Intronic