ID: 1180859175

View in Genome Browser
Species Human (GRCh38)
Location 22:19067290-19067312
Sequence AGGAAAAGCCACCACTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180859175 Original CRISPR AGGAAAAGCCACCACTGAAA TGG (reversed) Intronic
900318111 1:2069457-2069479 AAGAAAAGGCACCACTAAACAGG - Intronic
900507621 1:3037524-3037546 GGCAAAAGCCAACATTGAAACGG + Intergenic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901584259 1:10274369-10274391 AGCAAAAAGCACCAATGAAAAGG - Intronic
902953588 1:19908026-19908048 AAATAAAGCCACCACTTAAAAGG - Exonic
903634911 1:24805862-24805884 AGGAAAAGAAACGAATGAAAAGG - Intronic
905357694 1:37396271-37396293 AGCAAAAGACAGCCCTGAAATGG + Intergenic
906533208 1:46535500-46535522 AGGGATAGCAACCACTAAAAGGG + Intergenic
908142113 1:61197038-61197060 AGGTAGAGCCATCACTGAAGTGG - Intronic
909760426 1:79279361-79279383 AAGAAAAGCCACTAAGGAAATGG + Intergenic
910174128 1:84410622-84410644 ATAAAAAGCCACCACGAAAAGGG - Intronic
910310877 1:85823070-85823092 AGGTATAGCGACCACTGCAATGG - Intronic
911250661 1:95572891-95572913 GGGAAATGCCACCATTGAAATGG - Intergenic
914711206 1:150215312-150215334 AGGAAAAGTCACAACTAAAGCGG + Intergenic
915170110 1:153971727-153971749 AGGAAAAGCCACACAGGAAATGG + Intronic
915275529 1:154785458-154785480 AGGAAAAGCTCCCCCTGAAGGGG - Intronic
915985639 1:160461569-160461591 TGGAAATGCTACCACAGAAATGG - Intergenic
915993034 1:160536278-160536300 AGAAAAAGCCACTTTTGAAATGG - Intergenic
916230313 1:162534995-162535017 AAGAACAGCCCCCTCTGAAAAGG - Intergenic
916643067 1:166752618-166752640 AGGAAAAGCTACCAAGCAAATGG + Intergenic
917073087 1:171174439-171174461 AGGACCAGGCACCATTGAAAAGG + Intergenic
919436683 1:197571524-197571546 TAGAAAAGGCACTACTGAAAAGG - Intronic
920207396 1:204302543-204302565 GGGGAAAGCCACCACTGGAGGGG + Intronic
921296726 1:213711612-213711634 AGGAAAAACCAGCACAAAAAGGG - Intergenic
923736406 1:236612328-236612350 AGGAGAAGCACCCATTGAAACGG + Intergenic
924035165 1:239929217-239929239 AGGAAAATCCAGAACTCAAAAGG - Intergenic
1063548541 10:7006018-7006040 AGCTAAAGCCGCCACTGAAAAGG + Intergenic
1065360314 10:24883459-24883481 AAGAAAGGCCACCACGAAAAAGG + Intronic
1066173789 10:32881613-32881635 AGGAAAAGACAGCAATCAAAAGG - Intronic
1066320403 10:34297593-34297615 GGAAAATGCTACCACTGAAATGG - Intronic
1066503088 10:36013808-36013830 AGGAAAAGCCAGCACTTACCTGG - Intergenic
1067193566 10:44093210-44093232 AGGAAGAGCCACCAAGCAAATGG + Intergenic
1067899759 10:50227009-50227031 AGGAAAAAGAAGCACTGAAAAGG + Intronic
1068705879 10:60074802-60074824 AGCAAAAGCCGCCTCCGAAAAGG - Exonic
1070114719 10:73517284-73517306 TGGAATAGCCACCTCTGAGAGGG - Exonic
1070447791 10:76524490-76524512 AACAAAAGCCTGCACTGAAAAGG - Intronic
1070609297 10:77922583-77922605 AGGAAAAACCACCCCAGACAAGG + Intronic
1071153706 10:82665794-82665816 AAGAAAAGTCACCACAGAGAGGG - Intronic
1072020392 10:91393234-91393256 AGGAAAAGACACAAAGGAAAAGG - Intergenic
1072131566 10:92499171-92499193 AAGAAAAACCACCAATAAAATGG - Intronic
1074838005 10:117317779-117317801 AAGAACAGCCACCAAAGAAAGGG + Intronic
1075357819 10:121798435-121798457 AGGAAAGGCAACTTCTGAAAGGG + Intronic
1077631998 11:3817238-3817260 AGGAAAAGCCAGAGCAGAAAGGG - Intronic
1078081870 11:8209874-8209896 TGGGAATGCCACCACTGACAGGG + Intergenic
1078153876 11:8781450-8781472 AGGAAAAGCCACCAAAGAAGGGG + Intronic
1079253207 11:18803002-18803024 AGCAAAAGTCATCTCTGAAAGGG - Intergenic
1080463936 11:32479700-32479722 AGGGAAAGGCAACACAGAAAAGG + Intergenic
1080464581 11:32484896-32484918 AGGGAAAGGCAACACAGAAAAGG - Intergenic
1082216127 11:49572129-49572151 GGGAAAAGCCAGCTATGAAAAGG - Intergenic
1084051128 11:66600643-66600665 AGGAAAAGACTCCACCAAAAAGG - Intronic
1084914162 11:72415396-72415418 AGGAAAAGCCTCAAGTGGAAAGG + Intronic
1085506180 11:77061337-77061359 AGGAAAAGTCAACATTGTAATGG - Intergenic
1086633461 11:89052349-89052371 TGGAAAAGCCAGCTATGAAAAGG + Intronic
1087315394 11:96596498-96596520 AGGAAAAGCCACTATTGAAGAGG + Intergenic
1087713796 11:101583688-101583710 GGGAAAAGTCACCACTTAAGGGG + Exonic
1087766973 11:102165594-102165616 GAGAAAAGCCACCTCTGAAGAGG + Intronic
1088358481 11:108967447-108967469 GGGAGAAGGCATCACTGAAAGGG + Intergenic
1090508217 11:127342469-127342491 AGGAAGAACAACCTCTGAAATGG + Intergenic
1091379881 12:50453-50475 AGGAAAAGGCGCCATTGAAGGGG + Intergenic
1093998390 12:25667318-25667340 AGGACAAGCCACAACTGAAGTGG - Intergenic
1095698045 12:45162901-45162923 AGGAAAATCTACCACACAAATGG - Intergenic
1096906484 12:54941406-54941428 GAGAAAAGTCAGCACTGAAAGGG + Intergenic
1097340041 12:58426905-58426927 AGGAAAAACCAGCACAAAAAGGG + Intergenic
1098525716 12:71484533-71484555 AGGAAAAGACCCCACTCAGAGGG - Intronic
1099297623 12:80849382-80849404 GGGAAAATCCTCCTCTGAAATGG - Intronic
1099875246 12:88396412-88396434 AGGAAAAGACACAACAAAAAAGG + Intergenic
1100461667 12:94805653-94805675 AGGGAAAGGCCTCACTGAAAAGG - Intergenic
1100485361 12:95020214-95020236 AGGATAAGCAATCACTGAAAAGG + Exonic
1101599927 12:106200328-106200350 AAGAAAAGCCTTCACAGAAAAGG - Intergenic
1101640445 12:106582834-106582856 AAGAAAAGCCGCCTCCGAAAAGG - Intronic
1103952971 12:124561652-124561674 GGGAAAAAGGACCACTGAAAGGG + Intronic
1105870575 13:24502528-24502550 TGGAAAAGCCAGCACGGAAGAGG - Intronic
1107332026 13:39311713-39311735 AGGAAAAGAAACCACAGAAAAGG + Intergenic
1107776863 13:43853287-43853309 AGGAAAATCCACCAAGCAAATGG + Intronic
1110717404 13:78721681-78721703 AGGAAAAACAACAACTCAAAAGG - Intergenic
1110961389 13:81630698-81630720 AGGAAAAACCAGCACAAAAAAGG + Intergenic
1111210202 13:85068321-85068343 CAGAAAAGCAACCACTAAAAAGG - Intergenic
1112260354 13:97872641-97872663 AGGAAACAACACAACTGAAAGGG + Intergenic
1114864195 14:26568021-26568043 AGGAAAAGATAACAATGAAAAGG + Intronic
1115044911 14:28979874-28979896 AGAAAAATCTACCAATGAAATGG + Intergenic
1115060282 14:29179963-29179985 ATAATAAGCTACCACTGAAACGG + Intergenic
1116772891 14:49147818-49147840 AGGAAAATCCACCAAGCAAATGG - Intergenic
1116914341 14:50508189-50508211 AGGAAAATCTACCAAGGAAATGG - Intronic
1117428354 14:55624679-55624701 AGGAAACACCAACAATGAAAGGG + Intronic
1117497470 14:56319878-56319900 AGGGTAAGACAGCACTGAAAGGG - Intergenic
1117524762 14:56588014-56588036 GGAAAAAGCCATCACTGTAATGG - Intronic
1117670263 14:58099309-58099331 GGGCAAAGCCACCACTTAGAGGG + Intronic
1123066177 14:105620590-105620612 AAGAAAAGCCAAAGCTGAAATGG + Intergenic
1123125108 14:105940759-105940781 AGGAAAAGCCTGCAGTGGAAAGG + Intergenic
1125029863 15:35065550-35065572 AGGAAAAGACACTACAGAACTGG + Intergenic
1125117395 15:36111149-36111171 AGTAGAGCCCACCACTGAAAAGG - Intergenic
1125718593 15:41834388-41834410 AGGAAAGGCCACCATGGAAGTGG - Intronic
1126892104 15:53217705-53217727 AGGAGAAGCTACCACTAGAAGGG + Intergenic
1128242872 15:66113367-66113389 ATTCCAAGCCACCACTGAAAGGG + Intronic
1129953783 15:79614882-79614904 AGGAAGAGGCACCAATAAAAGGG + Intergenic
1130680308 15:85990686-85990708 TTGGAAAGCCACCACGGAAAGGG - Intergenic
1130777250 15:86997492-86997514 GGAAAAAGCCACAATTGAAAAGG - Intronic
1132037592 15:98499909-98499931 AGTAACAGACACCAATGAAACGG - Intronic
1133091554 16:3408348-3408370 AGGAAAATCCACAACAGGAAGGG + Exonic
1134184510 16:12074011-12074033 AGGAAGAGCCACCAAGCAAATGG - Intronic
1134264718 16:12683348-12683370 GGGGAAGGCCACCATTGAAAGGG - Intronic
1137476968 16:48817542-48817564 AGCAAAAGCAAAAACTGAAATGG + Intergenic
1137848101 16:51711726-51711748 GGGCAAAGCCACCAATGAGAAGG + Intergenic
1138259151 16:55600946-55600968 AGGAAAATCCACCAAGCAAATGG + Intergenic
1141472633 16:84249873-84249895 AGCAGATGCCACCACTGCAAGGG + Intergenic
1143652373 17:8271411-8271433 AAGAAAAGCCACCACTTGGAGGG - Intergenic
1143793490 17:9317288-9317310 AGGAAGAGCCGGCACTGAAGAGG + Intronic
1146080548 17:29776428-29776450 AAGTAAAGCCACCACTGTGATGG + Intronic
1148388299 17:47252543-47252565 GGGAAAAGCCAGCTCTGCAAAGG - Intergenic
1149405278 17:56343140-56343162 AGGAAAAGCTACCAAACAAATGG - Intronic
1152099905 17:78294890-78294912 AGGAAAAGCAACCACTCACCAGG - Intergenic
1152494954 17:80664498-80664520 GGGAAGAGCAAGCACTGAAAGGG - Intronic
1154311404 18:13269589-13269611 AGCAGAAGCCACCACGCAAATGG - Intronic
1155155553 18:23154359-23154381 ATGAAAAACCACCAATAAAATGG - Intronic
1155419412 18:25638515-25638537 AGCAAAAGCCACAAATGGAATGG - Intergenic
1156112890 18:33748630-33748652 AGACAAAGACACCACTGATAAGG - Exonic
1157460211 18:47885054-47885076 AACAAAAGCTAACACTGAAAGGG + Intronic
1157687825 18:49657037-49657059 AGGAAAAGCCACCTCTGCCAAGG + Intergenic
1158277945 18:55789321-55789343 AGGAGAAGCCAGCAGTAAAAAGG - Intergenic
1159287204 18:66369925-66369947 AGAAAAAGGCATCACTGGAAAGG - Intergenic
1159462659 18:68740590-68740612 AGGAAAATCCACCAGTGCAGTGG + Intronic
1161744051 19:6044089-6044111 AGGAACAGCAGCCACAGAAAAGG + Intronic
1164406027 19:27947514-27947536 AGGAAAATCTACCAAGGAAATGG - Intergenic
1165638529 19:37364252-37364274 ATGCAAAGGCACCACTCAAAAGG - Exonic
1166939544 19:46354436-46354458 CAGAAAACCCACCACTGAATAGG + Intronic
928900562 2:36313684-36313706 AGGAAGAGCTACCACAGAAACGG - Intergenic
929735693 2:44546941-44546963 AGTAAAAACCCCCACTAAAAAGG - Intronic
929924177 2:46195597-46195619 AGGAAAAACCACCACCCAGATGG - Intergenic
929995535 2:46823943-46823965 AGGAAAAGCCACAATGGGAAGGG + Intronic
930422518 2:51171185-51171207 AGCAAAAGCCAGCAGTTAAATGG - Intergenic
931077058 2:58727151-58727173 GGGAAAAGCCACTACTGATTAGG - Intergenic
933177755 2:79195010-79195032 TGGAATTGCCACCACTGAGAAGG + Intronic
935009994 2:99125527-99125549 AAGAGAAGCCAACACTGAAATGG - Intronic
935289617 2:101599031-101599053 AGGAAAAGCAACCAGTGAGCAGG + Intergenic
936382341 2:111997657-111997679 AGCAAAAGCCAGGCCTGAAAAGG + Intronic
937315674 2:120930768-120930790 AGGCAGAGCCCCCACTGAGAAGG + Intronic
937957217 2:127428149-127428171 AGGAAAAGTCACCGTTGATAGGG + Intronic
939462855 2:142519118-142519140 AGGAACAGACACTACTGATAAGG + Intergenic
941205203 2:162563442-162563464 AAGCAAAACCACCACTGAGAAGG - Intronic
942760991 2:179398144-179398166 AGGTAAAAACACTACTGAAAAGG - Intergenic
943115595 2:183665923-183665945 AGTAAAAGACACAACTAAAAAGG + Intergenic
944213689 2:197232522-197232544 AGGAAAATCAATCTCTGAAAAGG + Intronic
945335479 2:208587886-208587908 AGGTAAAGCCACCAAGAAAAGGG + Intronic
946400221 2:219464692-219464714 AGAGGATGCCACCACTGAAAGGG + Intronic
946952411 2:224891830-224891852 AAGAAAAACCACCAGTGAAGTGG - Intronic
946977252 2:225166881-225166903 GGGAAATGCCACCATTAAAAAGG - Intergenic
947875084 2:233462473-233462495 AGAAGAAGCCAGGACTGAAAAGG - Intronic
948803097 2:240441676-240441698 AAGAAAAGCCACCACAGGCACGG - Intronic
1169621931 20:7516982-7517004 AGTAAAATACCCCACTGAAAAGG + Intergenic
1170386034 20:15818066-15818088 AGGAAAAGCCACCACAGGGTGGG - Intronic
1172003551 20:31800937-31800959 AGGAAAAGTTACCAGTGAGAGGG - Intronic
1172987923 20:39007821-39007843 AGGGAGAGCCAGGACTGAAAGGG + Intronic
1173600056 20:44288361-44288383 GGGAAGTGCCACCACTGAAATGG - Intergenic
1174595531 20:51680402-51680424 AGGAACAGCCACCTCTTAGAAGG - Intronic
1175815510 20:61881325-61881347 ACGAAATGCCACCGCTGGAATGG - Intronic
1176904867 21:14488009-14488031 ATGAAAAGGCAGCACTAAAATGG + Intronic
1177623671 21:23630705-23630727 AGAAAAAAACACAACTGAAATGG - Intergenic
1177814592 21:25962257-25962279 AAGAACAGGCACCACCGAAATGG + Intronic
1177919183 21:27129344-27129366 AGGAAAAGTCACAACTGGGAAGG + Intergenic
1180859175 22:19067290-19067312 AGGAAAAGCCACCACTGAAATGG - Intronic
1181490222 22:23256814-23256836 AGGAAAAGCCAACAGAGAACAGG - Intronic
1184921926 22:47611318-47611340 TGGAAAATCTACCACTGGAATGG - Intergenic
951394390 3:22147527-22147549 AGGAAAACCCACCTGAGAAAAGG + Intronic
951606083 3:24436283-24436305 AGGAAAGCCCAGCACTGTAAGGG + Intronic
952925129 3:38314924-38314946 AAGAAAAGCCAGGACTGGAATGG + Intronic
953047350 3:39305567-39305589 AGGAAAAACCAGCACAAAAAAGG + Intergenic
953328653 3:42033951-42033973 TGGAGAAGCCACCACTGGACAGG - Intronic
956119347 3:65950722-65950744 GGCAAAAGCCACCACTTAAATGG + Intronic
956386259 3:68723228-68723250 AGGAAAATTCACCAAAGAAATGG - Intergenic
958857920 3:99409116-99409138 TGGAAAAGCCACCTCAGACAAGG + Intergenic
959105857 3:102063686-102063708 AGTAAAATCCAGCACTGAGAGGG - Intergenic
959516176 3:107269561-107269583 TGGAAGAGCCAACACTGAAATGG - Intergenic
960528581 3:118738275-118738297 GGGAAAAGCCATGACTGAAATGG - Intergenic
960620737 3:119634312-119634334 AAGAAAAGCCAACACTGAGATGG - Intergenic
962010768 3:131388162-131388184 AGGAAAATCTACCTCTGATATGG + Intronic
962596809 3:136954631-136954653 AGGAAAAGCAAGCAGAGAAAAGG - Intronic
964187335 3:153962675-153962697 AGGAAGAAGCACTACTGAAAGGG - Intergenic
964294926 3:155223497-155223519 AGGAAAATCCACCAAGCAAATGG - Intergenic
965054185 3:163693794-163693816 ATAAGAAGCCACCACTTAAAGGG + Intergenic
966000328 3:174941842-174941864 AGGAAAATCCACCATGCAAATGG - Intronic
966152571 3:176880102-176880124 AGGAAAAGCTACCAAGCAAATGG + Intergenic
969226869 4:5804442-5804464 AGAAAAAGTCAACACTGAGAAGG - Intronic
969253754 4:5988968-5988990 AGGAAAATGAAACACTGAAAGGG - Exonic
970138171 4:12949449-12949471 ATGTAAACCCACCACTGAACAGG - Intergenic
970818209 4:20182990-20183012 AGGAAAAAGAAACACTGAAAAGG - Intergenic
974347278 4:60698120-60698142 AGGAAGAGCCACCAAGCAAATGG + Intergenic
975541587 4:75517927-75517949 AGGGAGAGCCTCCATTGAAAGGG + Intronic
975610588 4:76198718-76198740 AGGAAAAGCCACCACTCTTGAGG - Intronic
976672700 4:87671849-87671871 AGGCAAGGACACCACAGAAAAGG + Intergenic
977912694 4:102556467-102556489 AGCAAAAGCAGCCAGTGAAATGG + Intronic
978090407 4:104707892-104707914 AGGAAAAACCAGCACGAAAAAGG + Intergenic
979217519 4:118183195-118183217 ATGAAAAGCCAGCAAAGAAATGG - Intronic
979233422 4:118371901-118371923 AGAAAAAATTACCACTGAAATGG - Intergenic
979583549 4:122388328-122388350 AGGAAAAGACACAACAAAAAAGG - Intronic
979964826 4:127065043-127065065 AGGCAAAGACACAACCGAAAAGG - Intergenic
980862454 4:138516013-138516035 GGGAAAAGCCTCCAGTGAGAAGG - Intergenic
981094140 4:140761096-140761118 AGGAAAACACACCACTGTGAAGG - Intergenic
981665726 4:147223877-147223899 AGGTAATGGCACCTCTGAAAAGG - Intergenic
981681161 4:147399844-147399866 TGTAAAAGACACCACTGTAAAGG - Intergenic
981738815 4:147981901-147981923 AGGAAAATCTACCACACAAATGG - Intronic
982634307 4:157873234-157873256 AGAAAAAGCTAATACTGAAAAGG + Intergenic
982899111 4:160975911-160975933 AGGAAATGTCACCATTGAGATGG + Intergenic
983588084 4:169376826-169376848 AGCAACAGACCCCACTGAAAAGG + Intergenic
983632323 4:169861821-169861843 AGGAAAAGGCAGCAGTGTAACGG + Intergenic
984041924 4:174745532-174745554 GGGAAAAGTCAGCACTTAAATGG - Intronic
986284944 5:6352233-6352255 ATCAAAAGACACCACTGAGAGGG + Intergenic
987585720 5:19853560-19853582 AGGGCAAGAAACCACTGAAAGGG + Intronic
990876591 5:60493540-60493562 AGGAATAGCCACCCCAGAGAAGG + Intronic
992609579 5:78495611-78495633 TGGAGAGGCCACCACTGAGAGGG + Intronic
993510137 5:88760907-88760929 AGAGAAAGCCATCACTGAGAGGG + Intronic
995285446 5:110383549-110383571 AGGAAAAGCAAACAATAAAAGGG + Intronic
996462964 5:123768581-123768603 AGGAAAATTCACCAAAGAAATGG - Intergenic
997099586 5:130954657-130954679 GGGAAAAGCCACCACTCATTTGG - Intergenic
997505463 5:134413086-134413108 TGGAAAATTCACCACTTAAAAGG - Intergenic
998154572 5:139777219-139777241 AGAAAAAGCCACTACAGAAGGGG - Intergenic
998461055 5:142310345-142310367 AGAATAAGCAGCCACTGAAAGGG - Intergenic
1000800746 5:165723157-165723179 AGCACAAACCACCACTAAAAAGG - Intergenic
1001289785 5:170448635-170448657 ATAAAAAGCCACAAGTGAAAAGG + Intronic
1002391658 5:178917999-178918021 AAGAAAAGGCCTCACTGAAAAGG - Intronic
1002609220 5:180403308-180403330 GGGAAAAGCCAGCACCCAAATGG - Intergenic
1003789671 6:9530717-9530739 AGGAAAAGTCACAACACAAAAGG + Intergenic
1004017377 6:11744465-11744487 ATGAAAAGGCACCACTGAGCAGG + Intronic
1004579828 6:16939323-16939345 AGGAAAAACCAGCTCTGAGAAGG + Intergenic
1004965453 6:20844515-20844537 AGGGAAACCCAACTCTGAAAGGG + Intronic
1005878195 6:30031659-30031681 AGGAAAATTCAGAACTGAAATGG - Intergenic
1006386197 6:33732360-33732382 AGGAACAGCCCCCACTGAGAGGG - Intronic
1007898920 6:45391961-45391983 AAGATGAGCCACCAATGAAATGG - Intronic
1007955313 6:45912719-45912741 AGGAACAAGTACCACTGAAAGGG - Intronic
1008972677 6:57387978-57388000 AGGAAAAGTCACTAATGCAAAGG + Intronic
1009161584 6:60289536-60289558 AGGAAAAGTCACTAATGCAAAGG + Intergenic
1011170641 6:84500773-84500795 AGGAAAATCCATCAAGGAAAGGG - Intergenic
1011207211 6:84913021-84913043 AGGAAAAGCCACTATAAAAAGGG + Intergenic
1012547087 6:100432481-100432503 AAGATAAGAAACCACTGAAAAGG + Intronic
1012647885 6:101711096-101711118 AACAAAAGCCAACACAGAAAAGG - Intronic
1012758589 6:103265270-103265292 AGAAAAAGGCAGTACTGAAAGGG - Intergenic
1015306913 6:131719258-131719280 AGGAGAAACAGCCACTGAAAAGG + Intronic
1016187589 6:141216763-141216785 GGGAAAAGTGACCACTGAAGTGG + Intergenic
1016592615 6:145763180-145763202 GGGTGAAGCCTCCACTGAAAGGG + Intergenic
1017672916 6:156784163-156784185 AGGAAAGGGCACCTCCGAAAAGG - Intronic
1020862465 7:13512037-13512059 AGGAAAAGCTACCAAGAAAATGG + Intergenic
1022446023 7:30471481-30471503 AGGAAAAGCCTCCACTGTGTGGG - Intronic
1022809435 7:33854504-33854526 AGTAAAAGCCAGCTCTGAAATGG + Intergenic
1023020256 7:36005568-36005590 AGGAATAGCCACCACTGACATGG - Intergenic
1023255619 7:38309726-38309748 ACAAAAAGCCTCCACTTAAAGGG - Intergenic
1023736653 7:43241571-43241593 AGGAAAAAAGACCACTCAAATGG - Intronic
1023932036 7:44711949-44711971 GGGAAAAGTCACTACTGAACAGG + Intergenic
1024634647 7:51276936-51276958 AGGAGAGGGCACCACAGAAAAGG + Intronic
1027861232 7:83584813-83584835 AGGAGAAGGGACCAGTGAAAGGG - Intronic
1028635509 7:92984834-92984856 AGGAAAAGCAATAACTAAAATGG - Intergenic
1030429147 7:109419584-109419606 AGGAAAATCCACCAAGCAAATGG - Intergenic
1030906475 7:115189751-115189773 AGCAAAAGCCACCTCTGATTTGG + Intergenic
1035624654 8:1061779-1061801 AGGAAAGCCCTCCACGGAAATGG - Intergenic
1036570098 8:9972791-9972813 AGAAAAAGCCAGCCCTGAAATGG + Intergenic
1037933622 8:22899438-22899460 CGGAAAAGCCACACATGAAAAGG + Intronic
1039905519 8:41783470-41783492 AGGAAAAGAGAATACTGAAAAGG - Intronic
1042264750 8:66897024-66897046 AAGAAAATCCAGCACTCAAAAGG - Intronic
1044348052 8:91129643-91129665 AGGACAACTCAGCACTGAAATGG - Intronic
1044903087 8:96970175-96970197 ATGAACAGCCTCCAGTGAAATGG + Intronic
1046619189 8:116509705-116509727 GGAAAAAGCCACCACTGGAGAGG + Intergenic
1047165720 8:122436259-122436281 TGGACAAGCCACCAGGGAAATGG + Intergenic
1047596142 8:126379597-126379619 AGAAAAAGCCCCAACTGAAAAGG + Intergenic
1049049210 8:140180779-140180801 AGGAAAAGCCACAAATTACATGG - Intronic
1049999826 9:1065547-1065569 ATGAAAAATTACCACTGAAAAGG + Intergenic
1050074088 9:1845883-1845905 AGGAAAAGCCCACAGTGAGATGG + Intergenic
1050247221 9:3703416-3703438 AGGAAAACCCTCCACTAACAAGG - Intergenic
1050591592 9:7165727-7165749 AGCAAAAGCCACCACTTCAGGGG - Intergenic
1051516663 9:17937276-17937298 AGATAAAGCCTCCCCTGAAATGG - Intergenic
1055252868 9:74329467-74329489 AGCAGAAGCAACCTCTGAAATGG + Intergenic
1056724925 9:89106463-89106485 TGGAGAAGCCACCACTGAAGGGG - Intronic
1059509777 9:114834275-114834297 AGGAAAATTTACCAATGAAATGG - Intergenic
1059901021 9:118925842-118925864 AGGAAAAGACACCTGTAAAATGG + Intergenic
1059940657 9:119356249-119356271 AGGAAAAGCCCTCACTGGGATGG - Intronic
1060790116 9:126480280-126480302 GGGAGAAGCCAACACTGGAAAGG + Intronic
1061842870 9:133369846-133369868 GGGAAAAGCAACCACTGGGAAGG + Intronic
1062070036 9:134550398-134550420 AGGCACAGCCACCACTGCCAGGG - Intergenic
1186343200 X:8664614-8664636 TGGAAAAGGCTCAACTGAAAGGG - Intronic
1186688841 X:11953390-11953412 AGAAAATGCCACTCCTGAAAAGG - Intergenic
1187445728 X:19359162-19359184 AGGAAAAGCCCCCACCCCAAGGG - Intronic
1188028990 X:25243124-25243146 AGGAAAAGACACAACTAATATGG + Intergenic
1188664752 X:32805003-32805025 AGGAAAAACCAGCACAAAAAGGG + Intronic
1190648760 X:52548162-52548184 TGGAGAAACCAGCACTGAAATGG - Intergenic
1191645918 X:63480618-63480640 AGGAAAATCCACCAAGCAAACGG + Intergenic
1195424651 X:104714504-104714526 AGCAAAAGGCACCACTTAACAGG - Intronic
1197031098 X:121817178-121817200 AGCAAAAGCCAAAATTGAAATGG - Intergenic
1198890400 X:141388651-141388673 AGAGAAAGTCACCAGTGAAAAGG - Intergenic
1199414558 X:147566211-147566233 TGGAAAAGGAACCAATGAAAGGG + Intergenic
1200976271 Y:9215166-9215188 AGGAAAGGCCACCACTGTTGGGG - Intergenic
1201214604 Y:11711368-11711390 AGGAAAGGACTCGACTGAAATGG + Intergenic
1202134897 Y:21651359-21651381 AGGAAAGGCCACCACTGTTGGGG + Intergenic