ID: 1180859925

View in Genome Browser
Species Human (GRCh38)
Location 22:19072344-19072366
Sequence ATCCAGCTGGTTCACCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180859921_1180859925 6 Left 1180859921 22:19072315-19072337 CCAACAGGAGGAGATTCCCAACG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1180859925 22:19072344-19072366 ATCCAGCTGGTTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 199
1180859920_1180859925 7 Left 1180859920 22:19072314-19072336 CCCAACAGGAGGAGATTCCCAAC No data
Right 1180859925 22:19072344-19072366 ATCCAGCTGGTTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 199
1180859919_1180859925 8 Left 1180859919 22:19072313-19072335 CCCCAACAGGAGGAGATTCCCAA 0: 1
1: 0
2: 1
3: 8
4: 126
Right 1180859925 22:19072344-19072366 ATCCAGCTGGTTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 199
1180859922_1180859925 -10 Left 1180859922 22:19072331-19072353 CCCAACGAAACATATCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1180859925 22:19072344-19072366 ATCCAGCTGGTTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 199
1180859916_1180859925 26 Left 1180859916 22:19072295-19072317 CCAGGTCAAGAAGAAAGTCCCCA No data
Right 1180859925 22:19072344-19072366 ATCCAGCTGGTTCACCCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180859925 Original CRISPR ATCCAGCTGGTTCACCCTCC AGG Intronic
900526705 1:3132858-3132880 ATCCAGCCGGTCCACTCACCCGG + Intronic
900811412 1:4804218-4804240 AGCTAGCTGGTTCTCCCTCAAGG + Intergenic
901857093 1:12051565-12051587 AGCCAGCTGGTTAACCACCCTGG - Intergenic
902330579 1:15729292-15729314 ATACATCTGGTTTCCCCTCCTGG - Intronic
903053823 1:20621109-20621131 ATCCGTCTGCTTCAGCCTCCTGG - Intergenic
903610025 1:24604331-24604353 ATCCACCTGCCTCAGCCTCCTGG - Intronic
903926789 1:26836077-26836099 GTGCAGCTGGCTCACCCTGCAGG + Intronic
904224776 1:29007196-29007218 ATCCTCCTGCTTCAGCCTCCCGG + Intronic
904245594 1:29185645-29185667 CTCCAGGTGATTCACCCGCCTGG + Intergenic
904312676 1:29639475-29639497 ATTCACCTGGCTCACACTCCTGG - Intergenic
904818314 1:33221781-33221803 ATCCATCTGTTTAACCCTCTAGG - Intergenic
904944272 1:34187833-34187855 CTCCACCTGATTCTCCCTCCAGG - Intronic
905637315 1:39563324-39563346 ATTCAGCTGTTTGAGCCTCCAGG - Intronic
909836494 1:80261164-80261186 ATCCAAATTGTTCACTCTCCTGG + Intergenic
910001583 1:82348841-82348863 ATGCAGCTAGTTCATCTTCCGGG + Intergenic
914215136 1:145619503-145619525 ATCCTCCTGCTTCAGCCTCCAGG - Intronic
914467083 1:147939891-147939913 ATCCTCCTGCTTCAGCCTCCAGG - Intronic
917092893 1:171371766-171371788 ATCCACCTGTTTCAGCCTCCTGG - Intergenic
917201714 1:172524182-172524204 TCCCAGCTAGTTCACCCTACAGG - Intergenic
917716813 1:177746722-177746744 TTCCAGCTTGTTCATCTTCCAGG - Intergenic
919936479 1:202254185-202254207 ATCCACCTGCCTCAGCCTCCCGG + Intronic
920926773 1:210348846-210348868 ATTCAGTTAGTTCACACTCCCGG - Intronic
923159061 1:231301901-231301923 ATGCACCTGGTTTACCCACCTGG + Intergenic
1064353847 10:14600744-14600766 ATCCTCCTGCTTCAGCCTCCAGG + Intronic
1064544898 10:16440307-16440329 ATCCACCTGCCTCAGCCTCCCGG + Intronic
1065387789 10:25150573-25150595 ATCCTCCTGATTCATCCTCCTGG + Intergenic
1067231967 10:44418330-44418352 ACTCAGCTGGTTTCCCCTCCTGG + Intergenic
1067569409 10:47360534-47360556 ATGCAACCGGTTCACACTCCAGG + Intergenic
1069756859 10:70778777-70778799 ATCCAGATCCTTCTCCCTCCAGG - Intronic
1069921676 10:71819360-71819382 AACCAGCTGTTTCTGCCTCCGGG - Intronic
1070325580 10:75386749-75386771 ATCCTGCTGGTCCTTCCTCCTGG + Intergenic
1072929563 10:99650282-99650304 ATCCTTCTGCTTCAGCCTCCTGG + Intergenic
1073533828 10:104256373-104256395 ATCCAGCTGTGTCATGCTCCTGG - Intronic
1075285150 10:121177553-121177575 ATCCTCCTGCTTCAGCCTCCTGG - Intergenic
1077357296 11:2124338-2124360 ATCCTCCTGGCTCAGCCTCCTGG + Intergenic
1080159877 11:29160850-29160872 AACCTACTGGTTCTCCCTCCAGG + Intergenic
1080632023 11:34086392-34086414 CCCCAGCTGGTTTGCCCTCCAGG + Exonic
1082859045 11:57836131-57836153 ATGCAGCAGGTTCAACCTCCTGG - Intergenic
1083247905 11:61444167-61444189 ATCCTGCTGCCTCAGCCTCCAGG - Intronic
1089350212 11:117817739-117817761 ATTCCGCTTGTTCACCCCCCAGG - Intronic
1091354349 11:134924125-134924147 ATGCAGGTGGTTCAGCATCCTGG + Intergenic
1091626458 12:2124699-2124721 ATCCAACTGGTTACCCGTCCAGG - Intronic
1093064240 12:14640023-14640045 ATCCAGTTGATTCACTCCCCTGG + Intronic
1096472789 12:51889626-51889648 ATCAATCTAGTTCACCTTCCTGG + Intronic
1097180223 12:57167611-57167633 ATCCAGCAGGGCCTCCCTCCAGG + Intronic
1098882220 12:75928191-75928213 ATCCAGGTGGTACACCAACCTGG + Intergenic
1098887161 12:75971729-75971751 ATCCTTCTGTTTCAGCCTCCTGG - Intergenic
1099056476 12:77847861-77847883 ATCCAGCTGGTGCAGCTGCCAGG + Intronic
1100814029 12:98368082-98368104 ATGCTGCTGGCTCACCCTCTAGG - Intergenic
1100865377 12:98851915-98851937 ATTCTGCTGCTTCAGCCTCCTGG - Intronic
1101317128 12:103639459-103639481 ATCCATCTGCCTCAGCCTCCCGG - Intronic
1102094986 12:110231669-110231691 ATCCTCCTGCTTCACCCTCCTGG - Intergenic
1103848189 12:123914325-123914347 ATCCAGGTCGTTCAGCCACCTGG - Exonic
1104928883 12:132328136-132328158 TTCCAGCTGCTCCACCTTCCCGG - Intronic
1105707804 13:22979355-22979377 GACCAGCCAGTTCACCCTCCAGG + Intergenic
1108362981 13:49684427-49684449 ATCCAGCTGCCTCGGCCTCCCGG - Intronic
1110219990 13:73061810-73061832 ATCCACCTGATTCACCATCTCGG - Intronic
1111641667 13:90977608-90977630 ACCCAGCTGTTTCAGCCTGCTGG + Intergenic
1111734489 13:92120362-92120384 ATCCTCCTGCTTCAGCCTCCTGG + Intronic
1117155137 14:52931786-52931808 ATCCGCCTGTTTCATCCTCCCGG - Intronic
1117339313 14:54780226-54780248 ATCCAGCTGGTTCACAACCAAGG - Intronic
1117408720 14:55430171-55430193 ATTCACCTGATTCACCCTGCAGG - Intronic
1117990456 14:61427825-61427847 ATCCACCTGCCTCAGCCTCCTGG + Intronic
1118114443 14:62759540-62759562 ATAAAGCTGGTTTACCCTCCAGG + Intronic
1118237950 14:64028012-64028034 ATCCTCCTGCTTCAGCCTCCCGG + Intronic
1119143730 14:72291365-72291387 ATCCACCTCCTTCACTCTCCAGG + Intronic
1120921349 14:89758484-89758506 ATCCACCTGCTTCAGCCTCCAGG - Intergenic
1121075622 14:91065891-91065913 TTCCAGCTGCTGCATCCTCCAGG - Intronic
1122525006 14:102375526-102375548 ATCCAGCTCGTTCTCACCCCAGG - Intronic
1127828362 15:62726632-62726654 ATCCAGCTGCACCACCTTCCTGG - Intronic
1127893039 15:63271622-63271644 ATCCACCTGCCTCAGCCTCCCGG - Intergenic
1133269208 16:4602385-4602407 ACCCAGCAGGTTCAGCCTCCTGG - Intergenic
1134223691 16:12375440-12375462 ACTCAGCTGGTTCTCTCTCCAGG + Intronic
1135812318 16:25599280-25599302 ATCCAGCATGATCTCCCTCCTGG - Intergenic
1135862434 16:26069056-26069078 ATCCTTCTGCTTCAGCCTCCAGG + Intronic
1136101357 16:27998678-27998700 ATCCTCCTGCTTCAGCCTCCCGG - Intronic
1139640636 16:68289048-68289070 ATCCATCTGCCTCAGCCTCCCGG - Intronic
1142734224 17:1884767-1884789 ATCCACCTGCCTCAGCCTCCTGG - Intronic
1143107496 17:4536893-4536915 CGCCAGCTGGTTCACCCTGGGGG - Exonic
1143622873 17:8091062-8091084 GTCCAGCTGGATCTCCCCCCTGG + Intergenic
1144772786 17:17769233-17769255 TGCCAGCTGGGTCACCCTCAGGG + Intronic
1146077207 17:29742423-29742445 ATCCTCCTGGGTCAGCCTCCTGG + Intronic
1148811073 17:50291704-50291726 GTCCAGAGGGTTCAACCTCCTGG - Intergenic
1151180387 17:72323028-72323050 CTCAAGCAGGTTCTCCCTCCGGG - Intergenic
1152652354 17:81500641-81500663 ATCCACCTGCCTCACCCTCTGGG - Intergenic
1153375258 18:4369908-4369930 CTCCAGCTGGGTCCCCTTCCTGG - Intronic
1154347716 18:13557189-13557211 ATCCTCCTGGCTCAGCCTCCTGG - Intronic
1158621090 18:59033002-59033024 ATCCTCCTGGCTCAGCCTCCTGG - Intergenic
1158971032 18:62666782-62666804 ATCCTCCTGCTTCAGCCTCCTGG + Intergenic
1160578229 18:79869129-79869151 GTCCAGCTGGGACAGCCTCCCGG + Intronic
1160759904 19:778430-778452 ATCCTCCTGCTTCAGCCTCCAGG + Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1163000950 19:14366873-14366895 TTCCAGCTCTTTCTCCCTCCAGG - Intergenic
1163208560 19:15822627-15822649 ATCCACCTGCCTCAACCTCCTGG + Intergenic
1163815831 19:19463868-19463890 AGACAGCTGCTTCACGCTCCTGG - Intronic
1163868435 19:19796040-19796062 ATCCACCTGCCTCAGCCTCCCGG - Intronic
1164232418 19:23302097-23302119 ATGTAGCTGTTTCAGCCTCCAGG - Intergenic
1164590820 19:29505817-29505839 ATTCTGCTGCTTCAGCCTCCTGG - Intergenic
1165528126 19:36373803-36373825 ATCCTCCTGCTTCAACCTCCTGG - Intronic
1166405184 19:42515565-42515587 ATCCTCCTGCTTCAGCCTCCTGG - Intronic
1166848872 19:45747975-45747997 ATCCTCCTGCTTCAGCCTCCTGG - Intronic
1167220533 19:48195845-48195867 TTCCAGCTGGGCCACCCTCCAGG - Exonic
931268086 2:60678305-60678327 ATACAGTTGTTTCAACCTCCTGG + Intergenic
933985050 2:87583976-87583998 TTCCAGCTGGTCCACCCGGCGGG - Intergenic
936308793 2:111366834-111366856 TTCCAGCTGGTCCACCCGGCGGG + Intergenic
936553234 2:113469248-113469270 ATTCTCCTGCTTCACCCTCCGGG + Intronic
937879523 2:126854944-126854966 ATACAGCAGGTTCACCCCACAGG - Intergenic
943034624 2:182726775-182726797 ATCCTGCTGCTGCACTCTCCAGG - Intronic
945022591 2:205589044-205589066 ATCCACCTGCCTCAGCCTCCTGG - Intronic
946333839 2:219024693-219024715 ATCCACCTGCCTCAGCCTCCCGG - Intronic
946355367 2:219181224-219181246 CTCCCGCTCTTTCACCCTCCTGG - Intronic
1170959251 20:21010476-21010498 CTCCAGGTGCATCACCCTCCTGG + Intergenic
1172111047 20:32545164-32545186 ATCCTCCTGCTTCAGCCTCCTGG - Intronic
1173718800 20:45235588-45235610 ACACAGCTGATTGACCCTCCTGG + Intergenic
1173933142 20:46838446-46838468 AGGCAGCTGGTGCAGCCTCCTGG + Intergenic
1175609715 20:60340440-60340462 GTCCAGCTGCTTCCCCCTGCTGG + Intergenic
1177129239 21:17236387-17236409 ATCCAGCAGGTTCAGCTTCCTGG - Intergenic
1179567079 21:42255977-42255999 CTCCAGCTGGTTCACTCTGGGGG - Intronic
1180859925 22:19072344-19072366 ATCCAGCTGGTTCACCCTCCAGG + Intronic
1184731544 22:46373620-46373642 ATTTGGCTGGTTCAGCCTCCCGG - Intronic
950519131 3:13485882-13485904 ATGCAGCTGGATCACCATCTTGG - Intronic
950774494 3:15337806-15337828 ATCCTCCTGCCTCACCCTCCTGG - Intronic
955504969 3:59623174-59623196 ATACAGCTGGTTCTCCCTCATGG + Intergenic
955798021 3:62658043-62658065 TCCCTGCTGGTTCCCCCTCCTGG - Intronic
956810869 3:72862825-72862847 AACCAGCTGGGTAACCTTCCAGG - Intergenic
961657693 3:128452457-128452479 ATCCTGTGGGTTCTCCCTCCAGG - Intergenic
966496642 3:180589350-180589372 TTCCAGCTGCTTCACCATCATGG + Intergenic
966973495 3:185066100-185066122 ATCCTCCTGCTTCAGCCTCCTGG - Intergenic
972928911 4:44047266-44047288 ATCCTGGTGGTGCACCTTCCTGG - Intergenic
974546934 4:63323410-63323432 ATCCATCTGGTTCCTCCTCAGGG - Intergenic
976729853 4:88250802-88250824 ATCCATCTGCCTCAGCCTCCCGG + Intergenic
978193205 4:105939931-105939953 ATCTAGCTGGTTGTCCCTACAGG - Intronic
978529652 4:109701201-109701223 ATCCACCTGCCTCAGCCTCCTGG + Intronic
980034568 4:127868920-127868942 ATCAAGATGCATCACCCTCCTGG - Intergenic
981688923 4:147484490-147484512 GACAAGCTGCTTCACCCTCCTGG + Intronic
981766754 4:148259500-148259522 TACCAGCTGGTTCAAGCTCCAGG - Intronic
983621149 4:169761900-169761922 ATCCACCTGCCTCAGCCTCCCGG + Intergenic
989725915 5:44586591-44586613 AGCCAGCTGCTTAACCTTCCTGG - Intergenic
990984206 5:61626416-61626438 ATCCGGGGGGTTCACCCGCCTGG - Intergenic
991241214 5:64462410-64462432 ATCCCCCTGCTTCAGCCTCCTGG - Intergenic
991934018 5:71784094-71784116 ATCCTGCTTGGTCACCCTCCAGG + Intergenic
992642470 5:78780078-78780100 AGCCAGCTGTTCCAGCCTCCAGG + Exonic
997623413 5:135315450-135315472 ATCCACCTGGCTCTCCTTCCAGG + Intronic
998915859 5:147010813-147010835 ATCCAGTTGGTTCACACATCTGG + Intronic
999233259 5:150075118-150075140 ATGCATCTGGTTCTCCCTCCAGG + Intronic
1001824561 5:174734774-174734796 AGCCAGCTCCTTCCCCCTCCAGG - Intergenic
1004129407 6:12904679-12904701 ATGTAGCTGGTTCACCCTGCAGG - Intronic
1004374314 6:15078449-15078471 ATCCTCCTGTTTCAGCCTCCTGG + Intergenic
1005421852 6:25659450-25659472 ATTCAGCTGCATCACCCTTCTGG + Intronic
1007508764 6:42359169-42359191 ATCAAGATGCTTGACCCTCCTGG + Intronic
1009434391 6:63601367-63601389 ATCCTCCTGGCTCAGCCTCCTGG + Intergenic
1011557829 6:88588047-88588069 AGCCCGCTAGTTCTCCCTCCAGG + Intergenic
1012733440 6:102910278-102910300 ACCCAGCTGGTTACCACTCCTGG + Intergenic
1015727492 6:136314466-136314488 ATCCACCTGGATCCACCTCCAGG - Intergenic
1017527170 6:155251526-155251548 ATCCACCTGCCTCAGCCTCCTGG + Intronic
1017765566 6:157604178-157604200 ATCCACCTGCCTCAGCCTCCTGG - Intronic
1018340942 6:162850639-162850661 CTCCAGGTGATCCACCCTCCAGG - Intronic
1019483813 7:1278557-1278579 ATCCTCCTGCTTCAGCCTCCCGG - Intergenic
1020077292 7:5266786-5266808 ATCCCGCTGCCCCACCCTCCTGG + Intergenic
1022888129 7:34667479-34667501 ATCCAGCTTCTTCACCCTCCTGG + Intronic
1023779738 7:43644631-43644653 ATCCTCCTGCTTCAGCCTCCTGG + Intronic
1024896293 7:54265825-54265847 ACCTAGCTGGTTCACCAACCTGG + Intergenic
1025870044 7:65422877-65422899 ATTTAGCTGTTTCAGCCTCCAGG + Intergenic
1025955823 7:66182194-66182216 ATCCTCCTGCTTCAGCCTCCTGG - Intergenic
1026131964 7:67628351-67628373 ATCCACCTGCCTCAGCCTCCTGG - Intergenic
1026143029 7:67722433-67722455 AGCCAGCAGGTTCACCCCCAAGG + Intergenic
1026476332 7:70739131-70739153 ATCCTCCTGCTTCAGCCTCCTGG + Intronic
1026677505 7:72440156-72440178 TTCCAGTTGGTTCTCTCTCCGGG - Intronic
1029367541 7:100126395-100126417 ATCCTCCTGCTTCAGCCTCCTGG - Intergenic
1030821115 7:114092992-114093014 ATCCTGCTTCTTCTCCCTCCAGG + Intronic
1032437701 7:131914042-131914064 ATTCTCCTGCTTCACCCTCCTGG - Intergenic
1032749999 7:134829886-134829908 ATCCAGGTGATTCTCCCTTCAGG - Intronic
1035378596 7:158424071-158424093 AACCTGCTGGACCACCCTCCAGG + Intronic
1036162790 8:6405788-6405810 CTCCAGCTGCTCCACCCTGCCGG - Intergenic
1037946935 8:22995666-22995688 ATTCAGCTCCTTCACCCTGCTGG + Intronic
1038395501 8:27242916-27242938 ATCCAGCTCCTTAACCCTGCAGG - Intronic
1041030725 8:53733196-53733218 GGACAGCTGGTTCACCCGCCTGG + Intronic
1042359931 8:67870798-67870820 ATCCATCTGCCTCAGCCTCCTGG + Intergenic
1043057581 8:75459095-75459117 ATCTAGCTATTTCACCCTTCAGG + Intronic
1043073914 8:75672305-75672327 ATCCAGACGGATCAGCCTCCAGG - Intergenic
1045869487 8:106908638-106908660 ATCCACCTGCCTCAGCCTCCCGG + Intergenic
1047408172 8:124602570-124602592 ATCAAGCTTGTTCAACCTGCAGG - Intronic
1047716221 8:127597648-127597670 ATCCAGCTTGTTCAGCACCCTGG + Intergenic
1049358558 8:142200827-142200849 ATCCTCCTGCTTCAGCCTCCCGG - Intergenic
1049727503 8:144155872-144155894 ATCCATCTGCCTCAGCCTCCCGG + Intronic
1049819917 8:144627225-144627247 TTTCAGCTGGTTGACCTTCCAGG + Intergenic
1050291388 9:4158989-4159011 ACCAAGCTGGTTCAGCCTTCAGG - Intronic
1051541816 9:18228524-18228546 ATCCTCCTGCTTCAGCCTCCTGG + Intergenic
1052042754 9:23758110-23758132 ATCCAGCTTATTCTACCTCCTGG - Intronic
1054942883 9:70763136-70763158 ATCCAGCTGAGTGACCTTCCAGG - Intronic
1055420684 9:76138013-76138035 TTCCAGCTGGTTTTCCTTCCTGG + Intronic
1057105440 9:92410709-92410731 ATCCAGATGCTGCACACTCCTGG - Intronic
1057194166 9:93107540-93107562 ATTCTGCAGGTTCACCCTCCTGG + Intronic
1058626302 9:106936700-106936722 ATCCAGCTGGGACACTATCCTGG + Intronic
1061125974 9:128675924-128675946 ATCCTCCTGCTTCAGCCTCCAGG - Intergenic
1061434160 9:130550470-130550492 ATCCTCCTGCTTCAGCCTCCTGG + Intergenic
1062228989 9:135470698-135470720 ATTCAGATGGTTCAGCCTCAGGG + Intergenic
1187294611 X:17986629-17986651 ATCTAACTGGTTCTCCCTCTGGG + Intergenic
1187886957 X:23897886-23897908 ATCCTCCTGCCTCACCCTCCTGG - Intronic
1188739697 X:33763561-33763583 ATCCAGGTGGATCAGCCTCTAGG + Intergenic
1190764697 X:53466197-53466219 ATCCGGCTGCCTCAGCCTCCTGG + Intergenic
1192339215 X:70248847-70248869 ATGCAGCTGCTTCATCCTCAAGG - Intergenic
1195718172 X:107839008-107839030 ATCCTCCTGCTTCAGCCTCCTGG - Intronic
1195809620 X:108815580-108815602 ATCCAGCTGCTTCAGGCTCATGG + Intergenic
1196263948 X:113619549-113619571 ATCCACCTGCCTCAGCCTCCTGG + Intergenic
1199381404 X:147176810-147176832 ATTCTGCTGCCTCACCCTCCTGG - Intergenic
1200182342 X:154158399-154158421 CTGCAGCTGCTTCTCCCTCCCGG - Intronic
1200187996 X:154195513-154195535 CTGCAGCTGCTTCTCCCTCCCGG - Intergenic
1200193646 X:154232653-154232675 CTGCAGCTGCTTCTCCCTCCCGG - Intronic
1200199401 X:154270457-154270479 CTGCAGCTGCTTCTCCCTCCCGG - Intronic
1201442426 Y:14022737-14022759 ATCCTCCTGGCTCAGCCTCCCGG - Intergenic
1202265355 Y:23012412-23012434 ATCTAGCTGGGTCAGCCTCAAGG + Intergenic
1202418348 Y:24646154-24646176 ATCTAGCTGGGTCAGCCTCAAGG + Intergenic
1202452438 Y:25023932-25023954 ATCTAGCTGGGTCAGCCTCAAGG - Intergenic