ID: 1180861083

View in Genome Browser
Species Human (GRCh38)
Location 22:19083388-19083410
Sequence GTGAAGAAGAGGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1375
Summary {0: 1, 1: 1, 2: 8, 3: 147, 4: 1218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180861083 Original CRISPR GTGAAGAAGAGGAATGAGGA GGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900891708 1:5454443-5454465 GGGAAGTAGAGAAATGGGGAGGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901565063 1:10107235-10107257 GCGAGGAAGAGGAAGGAGAAAGG - Intronic
901582160 1:10253399-10253421 GGGAAGCTGAGGCATGAGGATGG + Intronic
901617474 1:10553249-10553271 GTGAAGAAGAGGGAAGAGTCTGG + Intronic
901636067 1:10670762-10670784 GTGAGGTAGAGGAGGGAGGAGGG - Intronic
901638088 1:10679678-10679700 GTGAAGATGAGGCAGGTGGAGGG - Intronic
902113096 1:14099362-14099384 GGGAACCAGGGGAATGAGGAAGG - Intergenic
902275036 1:15333347-15333369 GGGAAGAGGAGGAAGGAGGAGGG + Intronic
902407272 1:16191635-16191657 GGGACCAGGAGGAATGAGGAGGG + Intergenic
902774379 1:18665288-18665310 GTGAAGGTGAGCAATGAGGCGGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903458033 1:23502095-23502117 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
904141745 1:28358841-28358863 GTTAATAAGTGGAATGATGATGG - Intergenic
904686804 1:32266655-32266677 GGGGAGGAGAGGGATGAGGAGGG - Intronic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
904974856 1:34448063-34448085 GGGGATAGGAGGAATGAGGATGG - Intergenic
904978961 1:34480273-34480295 GGGAGCAAGAGGAATAAGGAAGG + Intergenic
905111723 1:35599812-35599834 GTGAACCAGAGTAATGGGGATGG + Intronic
905324753 1:37143410-37143432 GGGAAGAAGAGGAGAGAGGAGGG + Intergenic
905800596 1:40839894-40839916 GTGAAGAAGTGGGGTGTGGAGGG - Exonic
906174131 1:43754715-43754737 GGGAAGATGAGGCAGGAGGATGG + Intronic
906302282 1:44691584-44691606 GTAGAGAAGAGGGACGAGGATGG - Intronic
906739401 1:48167402-48167424 GTGAAAAAAAAGAATGAAGAGGG - Intergenic
906784494 1:48602829-48602851 AAGAAGAAAAGGAATGAAGAGGG - Intronic
906833765 1:49061070-49061092 GCAAAGGAGAAGAATGAGGAGGG + Intronic
907380044 1:54079627-54079649 GTGAAGAAGAGGCAGAAAGATGG - Intronic
907705375 1:56828020-56828042 TTGAACAAGAGGACTGGGGATGG + Intergenic
907930912 1:58999182-58999204 TTGAAGATGAGGAATTAGGCTGG + Intergenic
908474278 1:64472289-64472311 GGAAAGAAGAGGAAGGAAGAAGG - Intronic
908516973 1:64902787-64902809 TTGAAGAAGAGGAAGGACAATGG - Intronic
908787165 1:67746588-67746610 GGGATGGAGAGGAATGAGGGAGG - Intronic
909195590 1:72618233-72618255 GGAAAGAAAAGGAATGAGAATGG + Intergenic
909273030 1:73648742-73648764 GTGAAGAAGAGCAGAGAAGAGGG - Intergenic
909821292 1:80065056-80065078 GTGAAGGAGAGGAATAAGAGAGG + Intergenic
910107880 1:83651246-83651268 GTGATGGAGAGGAATGAGGAAGG + Intergenic
910705153 1:90121852-90121874 GTAAACAAGTGAAATGAGGATGG + Intergenic
910806340 1:91192676-91192698 GTGCAGAAGAGGATGGTGGAGGG + Intergenic
910832435 1:91474275-91474297 GTGCAAAAGAGGAATGAGAAGGG - Intergenic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
910981820 1:92965680-92965702 GAGTAGGTGAGGAATGAGGAAGG + Intergenic
911018585 1:93363168-93363190 GTTAAGATGGGGAAAGAGGAGGG - Exonic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911147716 1:94568637-94568659 GTGAGGAAGAGGAAAGAATATGG + Intergenic
911201007 1:95043708-95043730 GGGAAGGAGAGGAAAGAGGAAGG + Intronic
911303234 1:96201852-96201874 TTGAAGAAGAGAAATGAAGGTGG + Intergenic
911344622 1:96681526-96681548 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
911883663 1:103271119-103271141 TTGAGGAAGAGGCATGTGGATGG + Intergenic
912164651 1:107028858-107028880 GTGAAGAATAATAATGAAGAAGG + Intergenic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912252871 1:108029379-108029401 GAGAAGAAGAGGGAAGGGGAAGG + Intergenic
912328038 1:108787407-108787429 GTGGAAAAGAGGGATAAGGAAGG - Intronic
912410595 1:109478305-109478327 GTGTAGAACAGGCAGGAGGAGGG - Intronic
912582368 1:110732248-110732270 GTGATGATTAGGAATGGGGATGG + Intergenic
912616326 1:111103333-111103355 TTGAAGAAGTGGAGTGAAGAAGG - Intergenic
912953770 1:114138164-114138186 GTCAAGAAGAGGAAGGAAAAGGG - Intronic
912959074 1:114179372-114179394 GAGAGGAAGAGGGATGAGGAAGG - Intergenic
913419653 1:118651275-118651297 CTGAAGAATAGGAATGAAAATGG - Intergenic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913478518 1:119262304-119262326 GTACAGAAGAGGGAAGAGGAGGG - Intergenic
913479793 1:119277037-119277059 GGGAAGCAGAGGCAGGAGGATGG + Intergenic
914844872 1:151277393-151277415 GAGAAGAACAGCAAAGAGGAAGG - Intergenic
914964361 1:152240941-152240963 GCCAAGAAGAAGAATGTGGAGGG - Intergenic
915281730 1:154827393-154827415 GTGAGATTGAGGAATGAGGAAGG - Intronic
915323450 1:155068787-155068809 GGGAAGGGGAGGAAGGAGGATGG + Intronic
915566403 1:156715894-156715916 GAGAAGAAGAGGAAGAAGAAGGG - Intergenic
915681801 1:157588765-157588787 GGGAAAACTAGGAATGAGGAAGG + Intronic
915830555 1:159125759-159125781 GAGAAAAAGAGGAGAGAGGAAGG + Intronic
915841085 1:159213568-159213590 GGGAAGAAGTGGAGGGAGGAAGG + Intergenic
915893889 1:159796058-159796080 TTTGAGAAGAGGAATGAGTAGGG + Intergenic
915900895 1:159846035-159846057 GAGAAAGTGAGGAATGAGGATGG - Intronic
916346546 1:163798050-163798072 TTGAAGAACAGGAAGGAAGAAGG - Intergenic
916473083 1:165142739-165142761 ATGAAGGAGAGAAAGGAGGAAGG - Intergenic
916635377 1:166662437-166662459 GTATAAAAGAGGACTGAGGATGG + Intergenic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917508586 1:175650859-175650881 GGGAGGAGGAGGAATGAGGTGGG - Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917717666 1:177754391-177754413 GTGGAGAGGAGAAATGAAGAAGG + Intergenic
917737192 1:177932196-177932218 GTGAAGACGTGGAAAGAAGATGG + Intronic
917873937 1:179268061-179268083 GTTAATAAGAGCAATTAGGAAGG + Intergenic
918069503 1:181124556-181124578 AGGAGGAAGAGGAACGAGGAAGG - Intergenic
918102143 1:181385743-181385765 GAGGAGAGGAGGAAAGAGGAAGG - Intergenic
918128872 1:181607798-181607820 GTGGAGATTAGGAATGAGGCTGG + Intronic
918138863 1:181703035-181703057 GAGAGGCAGAGGAAGGAGGATGG - Intronic
918477987 1:184946465-184946487 CTCAAAAAGAGGAAAGAGGAAGG + Intronic
918514622 1:185349317-185349339 TTGAAGGAGAGAAATGGGGAGGG - Intergenic
918702370 1:187621037-187621059 GTTTAGAAGTGGAATAAGGAAGG - Intergenic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919733715 1:200931001-200931023 GTGAGGGAGAGGAAAGAGCAAGG - Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920201047 1:204259812-204259834 GGGAAGAAGAGGAGTGGGGAAGG + Intronic
920412654 1:205774565-205774587 GTGAAGATGAGAAATAGGGAAGG - Intronic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
921137890 1:212278671-212278693 GTGAGGAAGAGGAAACAGGGAGG - Intergenic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
921798934 1:219379934-219379956 GTGAAGAAGAGGCAGGAAGGAGG + Intergenic
922158374 1:223058565-223058587 GTGAACAATAGAAATGAAGAGGG - Intergenic
922191536 1:223323174-223323196 GTGACAAAAAGGAAGGAGGAAGG + Intronic
922225269 1:223640563-223640585 GTGAGGAAAAGGAATCAGAATGG - Intronic
922554422 1:226521972-226521994 GTGAAGACAAGTAAGGAGGATGG - Intergenic
922569517 1:226625726-226625748 GTGAAGCAGAGGAGAGATGATGG - Intergenic
922729495 1:227942345-227942367 GTGCAGAGCAGGAAGGAGGAAGG + Intronic
922858598 1:228796075-228796097 GTGAAGAAGAGTATGGAGGATGG - Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
922895481 1:229096895-229096917 GGGAAGAAAAGGGATGGGGAAGG + Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923134536 1:231106630-231106652 GAGAGGGAGAGGAAGGAGGAGGG - Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923378668 1:233392609-233392631 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923668109 1:236016372-236016394 GTGAGGAAGAGGCAAGAAGATGG + Intronic
923852780 1:237815620-237815642 ATGAAGGAGAGCAGTGAGGAAGG + Intronic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
923935640 1:238757163-238757185 GGGAAGGGGAGGAAAGAGGAGGG + Intergenic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924146684 1:241083561-241083583 GTGAAGAAGATGAAAAAGAAAGG + Intronic
924178853 1:241420778-241420800 GTGAAGAAGATATATGAGGCTGG - Intergenic
924330321 1:242935031-242935053 GTGAGGAAGGGGAGTGATGAAGG - Intergenic
924371825 1:243359132-243359154 GTCACCAAGAGGAAGGAGGAAGG - Intronic
1062972198 10:1656878-1656900 ATGAAGTAGAGGCATTAGGATGG + Intronic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063560132 10:7118564-7118586 GTGAAGAACAGCAATCAGGGTGG - Intergenic
1063936302 10:11082105-11082127 GTGGAGGGCAGGAATGAGGAAGG + Intronic
1063974135 10:11401878-11401900 ATTAAGAAAAGGAATCAGGACGG + Intergenic
1064315072 10:14247698-14247720 GTGAAGAAGAGGGAAGAGAGGGG + Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1065044930 10:21738659-21738681 GTTAAGATGAAGAATGAGAAGGG - Intronic
1065866449 10:29919189-29919211 AGGAAGAAGAGGAGAGAGGAGGG - Intergenic
1065966984 10:30778724-30778746 GAGAAGAAGAAGGATAAGGAGGG + Intergenic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1067859224 10:49827496-49827518 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1067936837 10:50620140-50620162 GTGAAGAAAGGGAAAGAGAAGGG - Intronic
1068143570 10:53036478-53036500 GGGAAGAAGAGGAATCAGACTGG - Intergenic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1069048227 10:63765110-63765132 GTGAAGATGAGGTAGGAGGTGGG - Intergenic
1069309002 10:67009895-67009917 GAGATGAAGAGGAGTGAAGAAGG - Intronic
1069889352 10:71643609-71643631 GTGAAGAAGAGGGACAAGCATGG - Intronic
1070352152 10:75602934-75602956 GGGAAAAAGAAGTATGAGGAGGG - Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070798326 10:79230167-79230189 GTGAAAGAGAGGAAGGAGAAAGG - Intronic
1070844882 10:79513606-79513628 GGGAAGAAGAGGAGAGGGGAGGG + Exonic
1071094389 10:81956522-81956544 GTGAATGAGAGGAATCAGGATGG - Intronic
1071132577 10:82411999-82412021 GTCAAGAAGAAGAATGAGTCTGG + Intronic
1071226025 10:83528416-83528438 GGGAAGCAGAGGAGTGAGGTTGG + Intergenic
1071274218 10:84038092-84038114 TTGAAGAAGAGGAATAGGGAGGG + Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1072085758 10:92077750-92077772 GGGAAGAAGAGGAGAGAGGATGG + Intronic
1072178958 10:92960667-92960689 ACAAAGGAGAGGAATGAGGAAGG - Intronic
1072301090 10:94063093-94063115 GGGAAGAAGAGGCATTAGGAAGG - Intronic
1073375912 10:103034391-103034413 TTTAAGGAGAGGAATGAGGTCGG - Intronic
1073385396 10:103123225-103123247 GGGAAGCAGAGGGAGGAGGATGG - Intronic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1074148468 10:110738141-110738163 GTGCTGAAGAGGAAAGAGGCAGG + Intronic
1074584665 10:114755484-114755506 ATGAAGCACAGGAATGAGTAAGG - Intergenic
1074656154 10:115589901-115589923 ATAAAGAAGAGCAATGAAGATGG - Intronic
1074676886 10:115861219-115861241 GCAAAGCAGAGGACTGAGGATGG - Intronic
1074679988 10:115895790-115895812 GTGCAGAAGAGGAATCAGGGAGG + Intronic
1074722514 10:116274490-116274512 AAGAAGAGGAGGAAGGAGGAGGG + Intergenic
1074773428 10:116748440-116748462 GAGAAGAGTAGCAATGAGGATGG - Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1075913790 10:126148842-126148864 GGGAAGAAGGGGAAAGAGGTCGG - Intronic
1076095650 10:127733484-127733506 GTGAAGAAGAGGACCCAGAATGG + Intergenic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1076290868 10:129344405-129344427 AAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1076927313 10:133498559-133498581 GTGGGGAAGAGGTATGTGGATGG - Intergenic
1077091265 11:779399-779421 GAGGGGAAGAGGAATGGGGAGGG - Intronic
1077258298 11:1599713-1599735 GGGAACAAGAGGAGGGAGGAAGG + Intergenic
1078105254 11:8354308-8354330 AGGATGAGGAGGAATGAGGAAGG - Intergenic
1078159275 11:8826949-8826971 GAAAAGCAGAGGAATGTGGAGGG + Intronic
1078192823 11:9106566-9106588 GTAAAGAAGAGCAAGGAGCAAGG + Intronic
1078241277 11:9532764-9532786 GTCAGGAACTGGAATGAGGAAGG - Intergenic
1078398995 11:11007725-11007747 GAGAACAAGAGGAAGCAGGAGGG - Intergenic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1079393125 11:20039432-20039454 GGGAAGGAGAGGAGGGAGGAAGG - Intronic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079445542 11:20553561-20553583 GGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1079549770 11:21680435-21680457 GTAAAGAAGAGGAGAAAGGAAGG + Intergenic
1079723678 11:23851550-23851572 GTGTAGACAAGGAAAGAGGATGG - Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080084344 11:28259932-28259954 GTGAGGAAGAGGAGTCAAGAAGG - Intronic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1080820984 11:35806366-35806388 GTGAAGAAGAGGACACATGAAGG + Exonic
1080931955 11:36820113-36820135 GTGAAGAAAGGCAATAAGGAAGG + Intergenic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1081106872 11:39080856-39080878 GAGAAGAAGAGGATTGAGAGAGG + Intergenic
1081361794 11:42189083-42189105 GTTAAGAAAATGAATTAGGAAGG - Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1082664310 11:55955528-55955550 TTGAAGAAGAGTAAAGAGGGAGG - Intergenic
1082728769 11:56769610-56769632 TTAAAGAAAAGGAATGAGAAGGG - Intergenic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1084594065 11:70106781-70106803 GTGGAGGAGAGGAGTGGGGAAGG - Intronic
1084733564 11:71089892-71089914 GTCAAGGGGAGGAAGGAGGAGGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1085140923 11:74140809-74140831 GAGATGAAGAGGGGTGAGGAGGG + Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085326568 11:75610975-75610997 GTGAGGAGGAGGGGTGAGGAAGG - Intronic
1085341175 11:75732542-75732564 GGGAGGAAGAGAGATGAGGATGG - Intronic
1085540978 11:77269346-77269368 GGGAAGAAAAGGAAGGAGAAGGG + Intronic
1085763987 11:79266458-79266480 TTGAAGAAGAGGAATGATACAGG + Intronic
1086267470 11:85018598-85018620 GTGAGGTAGAGGTATGAGAAAGG - Intronic
1086496156 11:87406342-87406364 GAGAAGAAGACTAATGGGGAAGG + Intergenic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087078822 11:94150667-94150689 GTGAAGAGCAGGAGTGAAGAGGG - Intronic
1087639254 11:100737891-100737913 CTGAGGAAGAGGAATGAGAGGGG - Intronic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088813847 11:113408614-113408636 GAGAAGCAGAGGAAAGAAGAAGG - Intergenic
1089271094 11:117301752-117301774 GTGAAGAAGAGGAAGGTGTTAGG - Intronic
1089391476 11:118104853-118104875 AGGAAGAGGAGGAAGGAGGAAGG - Intronic
1089624765 11:119744296-119744318 GTGATGAAGAAGAAAGGGGATGG - Intergenic
1089957539 11:122585646-122585668 GAGAAAAAGAGGCAGGAGGAAGG + Intergenic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090124526 11:124071952-124071974 GCTCAGAAGAGGAATGATGAAGG - Intergenic
1090650683 11:128803386-128803408 CTGAAGTAGAGCAATGTGGAGGG - Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1091145168 11:133273221-133273243 GTGAACCAGAGGGATGGGGAGGG + Intronic
1091164885 11:133466774-133466796 GTGAAGAGGAAGAAAGAAGAAGG + Intronic
1091173709 11:133541432-133541454 GTGAAGAGCAGGAATGCGGAAGG + Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091337223 11:134781514-134781536 GTGGAAAAGAGGAAAGAAGAGGG - Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091375277 12:21060-21082 CTCAAGAAGGGTAATGAGGATGG + Intergenic
1091469208 12:712176-712198 GGGATGGAGAGGAAAGAGGAGGG + Intergenic
1091509426 12:1107155-1107177 GAGAAGAAGAGGAACAAAGAAGG - Intronic
1091910605 12:4227447-4227469 GTGAGGAAGAGAGGTGAGGAAGG - Intergenic
1092358485 12:7816531-7816553 GTGAAGAAGAAAAAAGAAGATGG - Intronic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1092518391 12:9240152-9240174 ATGAAGAAGAGGAAGAAGGTGGG - Intergenic
1092796091 12:12111320-12111342 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
1092927314 12:13283053-13283075 GTGAAGAACAGGAAAGGGGAGGG + Intergenic
1092969546 12:13678982-13679004 AGGAAGAAAAGGAAAGAGGAAGG + Intronic
1092969551 12:13679017-13679039 AGGAAGAAAAGGAAAGAGGAAGG + Intronic
1093049957 12:14493245-14493267 CTGAAGAACAGGCATGGGGATGG - Intronic
1093511188 12:19930309-19930331 GTGGAGAAGAGGCATAAGAAAGG - Intergenic
1093971782 12:25382564-25382586 GAGAAGAAGGGGCATGAGGACGG + Intergenic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094389706 12:29935591-29935613 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1094427073 12:30327169-30327191 CTGAAGAAAAGGTATGTGGAAGG - Intergenic
1095732273 12:45519053-45519075 ATGAGGAAGAGCAATGTGGAAGG - Intergenic
1095815413 12:46416799-46416821 AATAAGAAGATGAATGAGGAAGG - Intergenic
1095896756 12:47287602-47287624 TGGAAGAAGAGGAATAGGGAAGG - Intergenic
1095985456 12:47996328-47996350 GTGACTAAGAAGAATGAAGATGG - Intronic
1096005578 12:48168224-48168246 GAAAAGAAGAGCAATGAGGAGGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096542049 12:52313405-52313427 GTGAAGGGGAGGAATGAAGAGGG + Intergenic
1096792646 12:54054442-54054464 GGGAAGGAGAGAAAGGAGGACGG - Intronic
1096923516 12:55115915-55115937 ATGAAGAAGAGGATTGCAGATGG - Intergenic
1097720032 12:63010507-63010529 GAGAGGAAGAGAAATGAAGAAGG - Intergenic
1097809208 12:64000179-64000201 GTGAAGAGGAGGAAAGATAAGGG + Intronic
1097860282 12:64512035-64512057 GGGAAGAAGAGAAAGGAGGGGGG + Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098040776 12:66352301-66352323 CTGAAGTAGAGGAAGGAGCAGGG + Intronic
1098194935 12:67989723-67989745 GGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1098203136 12:68078498-68078520 GCGAAAAAGAGGGAGGAGGAAGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1098853102 12:75621037-75621059 TTGAAGAAGAGAAATAAGGTAGG + Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099064936 12:77964000-77964022 GGGAAGAGGAGGGAGGAGGAGGG - Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099975620 12:89542838-89542860 TTGAAGAAGAGGAGAGAGGTTGG - Intergenic
1100184793 12:92127646-92127668 GGGGAGAAGAGGAGGGAGGATGG + Intronic
1100383002 12:94079168-94079190 CTGATGAAGAGGAATGGGGTGGG + Intergenic
1100511877 12:95283498-95283520 GGCAAGAAGTGGAATGGGGAAGG + Intronic
1100622887 12:96297175-96297197 CTGAAGAAGAGTTATGAGGCTGG + Intronic
1100767514 12:97884194-97884216 GTGAAAAAGAGGACAGAGAAAGG + Intergenic
1100799422 12:98215739-98215761 GAGAAGAAGAGGAACTAGCAAGG - Intergenic
1101008670 12:100427500-100427522 AGGAAGATGAGGACTGAGGATGG + Intergenic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101062296 12:100984755-100984777 GTGAAAAAGAGGAAGCAAGAAGG - Intronic
1101124324 12:101615349-101615371 AGGAGGAAGAGGGATGAGGAAGG - Intronic
1101253670 12:102957533-102957555 GGGAGGAAGAGGTAAGAGGAGGG + Intronic
1101344961 12:103878500-103878522 GGGAAGAAGAGGCTTGAGGAGGG - Intergenic
1101585739 12:106083984-106084006 GAGAGAAAGAGGAAGGAGGAGGG + Intronic
1101695537 12:107122306-107122328 GAGAAGAAGAGGAAGGAGGTTGG + Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102123539 12:110462137-110462159 GTTAAAAAGAGGACTTAGGATGG - Intronic
1102167964 12:110821038-110821060 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1102746228 12:115251332-115251354 GAGAAGAAGAGAGAAGAGGAAGG + Intergenic
1102746242 12:115251426-115251448 GAGAAGAAGAGAGAAGAGGAAGG + Intergenic
1102746257 12:115251520-115251542 GAGAAGAAGAGAGAAGAGGAAGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103204787 12:119120135-119120157 GAGAAGGAGAGAAAGGAGGAAGG - Intronic
1103246740 12:119464390-119464412 GGGAGGAAGAGGAAAGGGGAGGG - Intronic
1103437466 12:120937820-120937842 GTGAGGGAGAGGAAGCAGGATGG - Intergenic
1103929895 12:124444553-124444575 GAGAAGCAGAGGAATGCGGTGGG + Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104509993 12:129368538-129368560 AGGAAGGAGAGGAATGAAGAAGG - Intronic
1104616356 12:130273306-130273328 GAGGAGGAGAGGAAGGAGGAGGG - Intergenic
1104668887 12:130667100-130667122 GAGAAAAAAAGGAATGAGGGAGG + Intronic
1105664482 13:22537300-22537322 GTGAAGAGGAGGATAGAGGGAGG + Intergenic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1105895947 13:24717607-24717629 GTGAAGCAGAGGAAAGGGCAGGG + Intergenic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1105972028 13:25438143-25438165 GGGCAGATGAGAAATGAGGAAGG + Intronic
1106169190 13:27274199-27274221 GAGAAAAACAGGAGTGAGGATGG - Intergenic
1106206768 13:27604421-27604443 GTAAAGAATAAGAATAAGGAGGG + Intronic
1106732148 13:32552433-32552455 GTGAAGAAGAGAAAAGTGGCTGG - Intergenic
1106900718 13:34352261-34352283 GTGAAAAAGAGGGATGAGGAAGG - Intergenic
1107025870 13:35800819-35800841 GGGAGGCTGAGGAATGAGGATGG - Intronic
1107376269 13:39808226-39808248 GGGAAGGAAAGGAAAGAGGAAGG - Intergenic
1107457509 13:40568376-40568398 GTAAAAGAGAGGAAGGAGGAGGG - Intronic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1107858279 13:44636441-44636463 GTGAAGAAGAGGGGCAAGGAAGG + Intergenic
1108563144 13:51666510-51666532 GTGGAGAAGAGGATGGAGGGAGG + Intronic
1108732148 13:53246327-53246349 GTGAAGAAGAGGAGAGAGAAAGG - Intergenic
1109106201 13:58253544-58253566 GCAAAGAAGAAAAATGAGGAGGG - Intergenic
1109276662 13:60311421-60311443 GAAAAGAGGAGGTATGAGGAGGG + Intergenic
1109902984 13:68797858-68797880 TGGTAGAAGAGGAATCAGGAAGG - Intergenic
1110120039 13:71868390-71868412 GAAAAGAAAAGGAAAGAGGAAGG - Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110486614 13:76051955-76051977 GTGTAGAGGAGAAAAGAGGATGG - Intergenic
1110533451 13:76623597-76623619 GAGAAAGAGAAGAATGAGGAGGG - Intergenic
1110565514 13:76953891-76953913 GTGTAGCAGAGGAAAGAAGATGG + Intronic
1110763818 13:79259702-79259724 GTGAAGAAGAGTAATGCTGCAGG + Intergenic
1110965531 13:81690225-81690247 ATGAAGAAGAGGAAGAAGGTGGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111698993 13:91662112-91662134 GGGAAGAAGAGAACTGAGGCAGG + Intronic
1111986659 13:95072749-95072771 GTGAAGAACAGAAGGGAGGAAGG - Intronic
1112066479 13:95798590-95798612 GTGAGGAAGAGGAAACATGATGG - Intergenic
1112104315 13:96223993-96224015 GAGAAGAGGAGGAAAGGGGAAGG - Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112410371 13:99157775-99157797 GGGAAGATGAGGCAGGAGGATGG - Intergenic
1112798206 13:103080754-103080776 GGGAAGAAGAGCTATGAGAAAGG - Intergenic
1112915181 13:104539487-104539509 GTGGAGGAGAGGTATGTGGAAGG + Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113450815 13:110408117-110408139 GAGCAGAACAGGAATCAGGAAGG + Intronic
1113678749 13:112227132-112227154 GAGGAGGAGAGGAGTGAGGAGGG - Intergenic
1113929014 13:113956723-113956745 GCGAAGAAGAGGAAGGAGACGGG - Intergenic
1114231333 14:20785668-20785690 GGGAAGAACAGGAAGAAGGAAGG + Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1115091100 14:29576765-29576787 GGGAAAAAAATGAATGAGGAGGG - Exonic
1115746341 14:36441482-36441504 GGGAAGCAAAGGAAGGAGGAAGG + Intergenic
1115787673 14:36844473-36844495 GAGAAGGTGAGGTATGAGGAAGG + Intronic
1116081021 14:40172400-40172422 TTGAGGAATAGGAATGAGAAAGG - Intergenic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116153943 14:41179125-41179147 GGGTAGTAGAGGAGTGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116427034 14:44803712-44803734 GTGAAAAAGAGAAATGTGGTTGG + Intergenic
1116475136 14:45331200-45331222 GAGAAGAGGAGGAAGAAGGAAGG - Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117558622 14:56912077-56912099 GTTAGGAACAGGAAGGAGGAAGG - Intergenic
1117810335 14:59539110-59539132 GTAAAGGATAGAAATGAGGAAGG + Intronic
1118043006 14:61937758-61937780 GAGAACTAGAGGAAAGAGGAAGG + Intergenic
1118297909 14:64587318-64587340 GTGAAGATGAGGAATCAGGAGGG + Exonic
1118348074 14:64954234-64954256 GTGAAGAGAAGGAGGGAGGAAGG + Intronic
1118857151 14:69632469-69632491 GGGAAGAAGAGAAAAGGGGAAGG - Intronic
1118910133 14:70055192-70055214 GTGAACAAGATGAATTAGGATGG - Intronic
1119545626 14:75469522-75469544 GTGACGAAGAGAGAGGAGGAGGG + Exonic
1119672138 14:76527934-76527956 GTAAGGAAGTGGAATGGGGAAGG - Intergenic
1119672463 14:76530042-76530064 GTGAAGAGGAGGAAGGACGGGGG - Intergenic
1119758775 14:77137106-77137128 GGGAACAAGAGGAATGGGAAAGG + Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120801040 14:88688853-88688875 GTGAAGAAGGGAGATGAGGTTGG - Intronic
1121049535 14:90811475-90811497 GTGAAGAAGAGGAGTCGGGGTGG - Intronic
1121081933 14:91115306-91115328 GTGAAGCTGAGGAAGCAGGAAGG + Intronic
1121476075 14:94204524-94204546 TTGAAAAAGAGGAATGAAGTAGG - Intronic
1121538632 14:94708455-94708477 TTTAAGGAGAGAAATGAGGATGG + Intergenic
1121883032 14:97517302-97517324 GTAAAGAAGAGGGTTGGGGAAGG - Intergenic
1121923297 14:97903650-97903672 GTGAAGGAGAGTAATGAGGATGG - Intergenic
1122020240 14:98831912-98831934 GTGAAGACAGGGAGTGAGGATGG + Intergenic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1202830767 14_GL000009v2_random:26907-26929 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1123778552 15:23603730-23603752 GAGAAGAGGAGGAATGAGCACGG + Intronic
1123914916 15:25014353-25014375 GTAAAGATTGGGAATGAGGAAGG + Intergenic
1124198064 15:27650607-27650629 GGGAAGAAGAGGAATGGGGGGGG - Intergenic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1124548146 15:30651916-30651938 GGGAAGAAGGGGAGGGAGGAAGG - Intronic
1124621235 15:31275261-31275283 ATGAAGGAGAGGATTGAGTACGG + Intergenic
1124702786 15:31931284-31931306 GGGAGGAAGGAGAATGAGGATGG + Intergenic
1125349956 15:38756118-38756140 GAGAAGAAGAGGCAAGAGGTGGG + Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125746951 15:42003789-42003811 GTGAAGAAGAGGGAGGAGTGAGG + Intronic
1125762297 15:42104923-42104945 GTGAGGAAGAGGGCTTAGGATGG - Intergenic
1126228496 15:46298384-46298406 GGTAAGAAAAGGAATGAGGGAGG + Intergenic
1126498551 15:49319594-49319616 TTGAAGATGAGCACTGAGGAAGG - Exonic
1127304989 15:57696849-57696871 GTGAAAAAAAGGAAAGAGAAAGG - Intronic
1127509436 15:59625472-59625494 GAGAAGAAGAGGAGTTAAGAGGG + Intronic
1128092976 15:64931456-64931478 CACAAGAAGAGCAATGAGGATGG - Intronic
1128127715 15:65205225-65205247 GTGAGGCTGAAGAATGAGGAGGG - Intronic
1128154286 15:65383077-65383099 GTGAAGAGGAGGCAGGAGGATGG + Exonic
1128354546 15:66915646-66915668 GCCAGGAAGAGGAATGAGGATGG + Intergenic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1128845960 15:70894755-70894777 GGTAAGAAAAGGCATGAGGAAGG + Intronic
1128941371 15:71790486-71790508 ATGAAGAACAGGCAAGAGGAAGG + Intergenic
1129310497 15:74705023-74705045 GTCATGAAAAGGAATGAGGCTGG + Intergenic
1129797938 15:78392151-78392173 GAGATGAGGATGAATGAGGATGG - Intergenic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1130216339 15:81973855-81973877 GGGAAGAAGAGGAAGAAAGACGG + Intergenic
1130226015 15:82058904-82058926 GGGAGGTGGAGGAATGAGGAGGG - Intergenic
1130510652 15:84586471-84586493 GTGAGGAAGAGTAAGGGGGAGGG - Intergenic
1131312606 15:91304566-91304588 GAGAAAAAGAGGGAGGAGGAAGG + Intergenic
1131354738 15:91734911-91734933 GAGAAGAAGAGGAAGAAAGAGGG + Intergenic
1131451594 15:92544958-92544980 GAGAAAAAGAGGTGTGAGGAGGG - Intergenic
1131654238 15:94438393-94438415 GAGAGGAATAGGACTGAGGAAGG + Intronic
1132097170 15:98995821-98995843 GTGAAGAGGAGGAAGGTGGTGGG - Intronic
1132127154 15:99237873-99237895 TTGAAGAGGAGGAATGGGGAGGG - Intronic
1132491538 16:234579-234601 GAGAAGGAGGGGAAAGAGGACGG + Exonic
1132799058 16:1742570-1742592 ATGAACAGGAGTAATGAGGATGG + Intronic
1133392851 16:5423083-5423105 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1133469244 16:6058293-6058315 AGGAAGAAGAGGAGGGAGGAAGG - Intronic
1133839255 16:9394020-9394042 GGGAAGAAGGGGGATGGGGAAGG - Intergenic
1134071952 16:11265758-11265780 TTGCGAAAGAGGAATGAGGAAGG + Intronic
1134998928 16:18760345-18760367 GGGAAGAGGAGGGAAGAGGAGGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135232054 16:20717812-20717834 AAGAAGAAGAGGAAGGAAGAAGG + Intronic
1135236695 16:20763468-20763490 GTGAGGCAGAGGAAGGAGAATGG + Intronic
1135533070 16:23271344-23271366 GGGAAGAGGAGGAATGAGACAGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136037429 16:27550450-27550472 GAGAAGTAGAGGTCTGAGGAGGG + Intronic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1136539119 16:30918826-30918848 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1136726884 16:32364983-32365005 GAAAAGGAGAGGAATGAGGTTGG - Intergenic
1137374556 16:47941598-47941620 TTGCAGAAGAGGAAGGAGTAGGG + Intergenic
1137386521 16:48047573-48047595 GGGAAGGAGAGAAAAGAGGAGGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137498888 16:48995354-48995376 TTAATAAAGAGGAATGAGGAGGG + Intergenic
1137557024 16:49477227-49477249 GAGAAGGAGGGGAAGGAGGAGGG + Intergenic
1137702080 16:50504475-50504497 GGGAAAAAAAGGAATGATGAAGG + Intergenic
1137707144 16:50543590-50543612 GTGAAGAAGAGCAGAGAGGCAGG + Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1137928422 16:52563761-52563783 GTGAAGAGGAGAGAGGAGGATGG + Intergenic
1138013312 16:53404852-53404874 ATTAAGAAGAGAAATGAGGCCGG - Intergenic
1138217153 16:55214470-55214492 GAGAAGAACAGGAAGGAGGGAGG + Intergenic
1138356277 16:56383542-56383564 GGGAGGAACAGGCATGAGGATGG - Intronic
1138992672 16:62410157-62410179 GTGACCAAGAAGAATGAGGTAGG + Intergenic
1139341345 16:66270035-66270057 GGGAAGAAGAGAGACGAGGAGGG + Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1139661068 16:68421231-68421253 GTGAAGCAGATGAGGGAGGATGG - Intronic
1139822099 16:69728812-69728834 GTTAACAAGATGACTGAGGATGG - Intergenic
1139946368 16:70645079-70645101 GGGAAGAGTAGGAAGGAGGAGGG + Intronic
1140026391 16:71293982-71294004 GAGCAGAAGAGGAAAGGGGAGGG + Intergenic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141527101 16:84618430-84618452 GGGAAGAAGAGGAAGGAGGAGGG - Intergenic
1142251465 16:88993827-88993849 GGGAGGAGGAGGAAGGAGGAGGG - Intergenic
1202999550 16_KI270728v1_random:152776-152798 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
1203131148 16_KI270728v1_random:1689175-1689197 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
1142857511 17:2739776-2739798 GAGAAGAAGAGGAAGAAGGGAGG - Intergenic
1143444204 17:6997522-6997544 GAGACGAGGAGGAATGAGGATGG + Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143615183 17:8045413-8045435 GTGAAGAAGAGTCAGGAGAATGG + Intronic
1143750717 17:9024967-9024989 GGGAAGAAAAGAAAAGAGGAAGG - Intronic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1143968003 17:10770671-10770693 GTGAGGAAGATGGATGGGGAGGG + Intergenic
1143993614 17:10988128-10988150 GTGTAGAAGAGGAATAAGGAAGG - Intergenic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144445730 17:15326356-15326378 ATGAAGCTGAGAAATGAGGAGGG + Intronic
1146006234 17:29162469-29162491 GTGAAGCGGAGGCAAGAGGAAGG - Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146551625 17:33785205-33785227 GTGAAGATGAAGAAAGAAGATGG + Intronic
1146564595 17:33901476-33901498 ATGAAAAAGAGGAATAAGGGAGG - Intronic
1146920157 17:36704705-36704727 GTGATGGAGAGAAAGGAGGAAGG - Intergenic
1147186386 17:38715589-38715611 CTGAAGGAGAGGAGAGAGGAAGG - Intronic
1147435534 17:40411376-40411398 GTGAAGAAGAAGAACAAGGGTGG - Exonic
1147621593 17:41871726-41871748 GTGAACAAGATGAAGAAGGAAGG - Exonic
1148069105 17:44896826-44896848 TTGAAGAATAGGAATCAGGTTGG - Intronic
1148073975 17:44925049-44925071 CAGTAGAGGAGGAATGAGGATGG - Intronic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148643335 17:49204516-49204538 GAAAAGATGAGGAATGAGAAAGG - Intronic
1148703738 17:49609484-49609506 GAGAAGAAGTGGAATGAAAACGG + Intronic
1148910832 17:50941795-50941817 GGGAAGAGGAGGCATCAGGAAGG - Intergenic
1149045846 17:52244475-52244497 CTGGAGGAGAGGAATTAGGACGG - Intergenic
1150218316 17:63482364-63482386 CTGAAAGACAGGAATGAGGAGGG - Intergenic
1150244581 17:63664814-63664836 GGGAAAAAGAGGAAGGAGGAAGG - Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150977233 17:70102184-70102206 GTGAACAAGAAGAAAGAAGAAGG - Intronic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151120402 17:71786794-71786816 GTGAAAAAGAGGGATCAGGAAGG - Intergenic
1151312767 17:73304384-73304406 GGGAAGCAGAGGTAGGAGGATGG - Intronic
1151548767 17:74809232-74809254 GGGAAGCAGAGGTTTGAGGAAGG + Intronic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1152009385 17:77701838-77701860 ATGAAAGGGAGGAATGAGGATGG - Intergenic
1152201091 17:78946747-78946769 GGGCAGAAGAGGAAGGAGGAAGG - Intergenic
1152319571 17:79600933-79600955 GTGAAGGAGGGGAGTGAGGAAGG + Intergenic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1152793220 17:82293209-82293231 GGGAAGAGGAGGGAAGAGGAGGG + Intergenic
1153084515 18:1269018-1269040 GTGAAAGAGGGGAGTGAGGAAGG + Intergenic
1153269975 18:3310748-3310770 GTGGAAAAGAGGAGTGAGGGAGG + Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1154150480 18:11902675-11902697 GTGTAGAAGAGGAATTATCAAGG - Intronic
1154155035 18:11937307-11937329 GAGAAGAAGAGGAGGGAGAATGG + Intergenic
1154286129 18:13058518-13058540 TTGAAGGAGAGGATTGAGGGTGG + Intronic
1155171852 18:23272595-23272617 GTGAACAAGAGGAAGGAGCTAGG + Intronic
1155176390 18:23304913-23304935 GTGAATAAGAAGACTGAAGAAGG - Intronic
1155457322 18:26031978-26032000 GGGAAGAAAAGGGATGAGAAGGG + Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156229690 18:35141233-35141255 AAGAGGAAGAGGAATGAGGCAGG - Exonic
1156260959 18:35444694-35444716 GAGAAGAAGTGGAAGGAGAAGGG + Intronic
1156491374 18:37498403-37498425 GGGGAGAAGAGGGAAGAGGAGGG - Intronic
1156511337 18:37639465-37639487 AGGAAGAAGAGGAAGAAGGAAGG - Intergenic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156752709 18:40478901-40478923 GAGAAGACTAGGAAAGAGGAAGG - Intergenic
1156796638 18:41053897-41053919 GTGAAATAAAGGGATGAGGAGGG - Intergenic
1156862091 18:41849194-41849216 GGGAAGAAGAAGAGGGAGGAGGG + Intergenic
1156934196 18:42682647-42682669 GAGAAGATGAGGAAGGAGAAAGG + Intergenic
1157112163 18:44831651-44831673 GTTATGAAGAGGAGTGAGTAAGG + Intronic
1157129794 18:44996137-44996159 GAGAAGAAGAGAAAAGAGGGAGG - Intronic
1157229898 18:45906022-45906044 ATTAAGAAGAGGACTGAAGATGG - Intronic
1157239825 18:45998582-45998604 GGAAAGAAGAGGAGAGAGGAAGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1158209056 18:55025798-55025820 GTGAAGAAGATGAAGGAGAAGGG - Intergenic
1158241118 18:55379543-55379565 AGGAAGAAGAGGAGGGAGGAAGG + Intronic
1158634945 18:59148202-59148224 GTGAAGAGGAAGATTGAGGCAGG + Intronic
1159092643 18:63867052-63867074 GTGAAGGGGAGGGAGGAGGAAGG + Intergenic
1159194212 18:65090848-65090870 GAGAAGAAGAGGAGTGGGGAAGG - Intergenic
1159229036 18:65580900-65580922 CTGAAGTAGAGTTATGAGGAGGG + Intergenic
1159374161 18:67570400-67570422 ATGAAGAAGATTAATGAGGTTGG + Intergenic
1159448943 18:68575747-68575769 GTGAAAAAGAGGAATAATGGAGG - Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159725050 18:71946919-71946941 GGGAAGAAAAGAAATAAGGAAGG - Intergenic
1159746314 18:72240237-72240259 TTGAAGAAGATGAATGAAGTTGG - Intergenic
1159915359 18:74183049-74183071 GGGAAGAAGAGGAGAGAGGTGGG - Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160299442 18:77667016-77667038 GAGAAGAAGAGGAGAGGGGAGGG - Intergenic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1160448687 18:78947160-78947182 GGGAAGAAGAGGACAGAGGAAGG + Intergenic
1160448695 18:78947190-78947212 GGGAAGAAGAGGATGGAGGAGGG + Intergenic
1160448713 18:78947260-78947282 GAGAGGAAGAGGATGGAGGAGGG + Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1160527339 18:79545404-79545426 GAGAGGATGAGGAATGAGGCTGG + Intergenic
1161803532 19:6429462-6429484 GAGGAGGAGAGGAAAGAGGAGGG + Intronic
1162050005 19:8027409-8027431 GTGCTGAATGGGAATGAGGATGG - Intronic
1162904709 19:13816875-13816897 GGGAATAAGGGCAATGAGGAGGG + Intronic
1163061267 19:14763904-14763926 AGGAAGAGGAGGAAAGAGGATGG - Intronic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163351103 19:16777299-16777321 GAGAAGAGGAGGAAAGGGGAGGG + Intronic
1163385512 19:16997552-16997574 GGGCAGAAGAGGAAAGAGGCTGG + Intronic
1163646783 19:18494060-18494082 GTGGAGAGGAGGAGTGAGGTTGG - Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164402745 19:27912835-27912857 GCCAAGATGAGGAATGGGGAGGG + Intergenic
1164441376 19:28282866-28282888 GGGAAGAAGAGGATGGTGGAGGG - Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164669823 19:30066184-30066206 CTGAAGAAGAGGCATGATGTGGG + Intergenic
1164897960 19:31893777-31893799 GAGCAGAAGAGGAAGAAGGAGGG + Intergenic
1165064475 19:33221015-33221037 GGGAAGAAGTGGGAGGAGGAAGG - Intronic
1165613626 19:37179131-37179153 GGGAACAAGAGGAATGTGGCAGG - Intronic
1165847392 19:38827054-38827076 GGGAAGGAGGGGAAGGAGGAAGG + Intronic
1165960307 19:39528689-39528711 GAAAAGAAGAGCAATGAGGGTGG + Intergenic
1165992711 19:39825628-39825650 GTCAAGGAGAGAGATGAGGATGG + Exonic
1166038779 19:40190030-40190052 GAGAAGAAGAGGAAATAAGAGGG - Intergenic
1166079618 19:40435423-40435445 GGGGAGCAGAGGAGTGAGGAGGG - Intergenic
1166089288 19:40497807-40497829 GAGAGGAAGAGGTGTGAGGATGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166393426 19:42422966-42422988 GTCAAGGAGAGGTAGGAGGAAGG - Intronic
1166561793 19:43737551-43737573 GTGGGGAGGAGGAATGAGGCAGG - Intronic
1166702333 19:44889267-44889289 GACATGAAGGGGAATGAGGAAGG + Intergenic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167527690 19:49995139-49995161 AGGAAGAAGAGGAAAGAGGCCGG + Intronic
1167609009 19:50497227-50497249 GAGAGGCAGAGGAGTGAGGAAGG + Intergenic
1167682289 19:50931185-50931207 GAGAGCAAGAGGATTGAGGAAGG - Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1167775472 19:51551815-51551837 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
1168289774 19:55351959-55351981 GGGAGGAGGAGGAAGGAGGAAGG + Intronic
1168312217 19:55466067-55466089 GAGCAGAAGAGGAACGAGCAAGG - Intergenic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168505131 19:56927723-56927745 CTGAAGACCAGGAATGATGAAGG + Intergenic
1202641926 1_KI270706v1_random:100869-100891 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
924989703 2:302123-302145 GTGAAGAAGCTGCATAAGGAAGG + Intergenic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925541746 2:4974753-4974775 CTAAAGAAGAGGCATGAGGCCGG + Intergenic
925572733 2:5329203-5329225 GTCAGGAAGAGGAATGGAGATGG + Intergenic
925599765 2:5596348-5596370 GTGAAGAAGTGGGAGGAGGCTGG - Intergenic
925881048 2:8352957-8352979 GGGAAGAGGAGGGAAGAGGAGGG + Intergenic
926092781 2:10061376-10061398 GGGAAGAAGAGAAATGGGCACGG + Intronic
926230820 2:11002633-11002655 GTGCAGAAAGGGAGTGAGGAAGG + Intergenic
926266787 2:11330727-11330749 GGGAAGATGAGGAGGGAGGAGGG + Intronic
926266804 2:11330777-11330799 GGGAAGAGGAGGAGAGAGGAGGG + Intronic
926266823 2:11330828-11330850 GGGAGGAAGAGGGAGGAGGAGGG + Intronic
926266832 2:11330850-11330872 GGGAGGAAGAGGGAGGAGGAGGG + Intronic
926294950 2:11562432-11562454 GGGAAGAAGAGTGATGAGCAAGG - Intronic
926893104 2:17655227-17655249 ATGATGAAAATGAATGAGGATGG + Exonic
927107678 2:19841953-19841975 GAGAAGAAGAGGAAAAAGGAGGG + Intergenic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
927295666 2:21450229-21450251 GTGAAAAAGAGGAAAAAGAAGGG - Intergenic
927438469 2:23090646-23090668 GAGAGAAAGAGGAAAGAGGAGGG + Intergenic
927553850 2:24019277-24019299 GTGAATCAGAGGACTGAGGTAGG - Intronic
927629605 2:24761195-24761217 CTGAAGGAGAGGAATAAGGATGG - Intronic
927880067 2:26684050-26684072 GAGAAGAAAAGGAAGGAGGCAGG - Intergenic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
928252188 2:29690910-29690932 GTGAAGATGAGAAGTGGGGATGG - Intronic
928269296 2:29841986-29842008 GTGAAGAGGAGGATGGAGGAAGG - Intronic
928358117 2:30639219-30639241 GTAAAGGAGAGGAATGAGGTGGG - Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
929021217 2:37555192-37555214 GCGAAGAAGAGTAAGGAGGAGGG - Intergenic
929059557 2:37909346-37909368 GGGAATGAGAGGAATGAGGAGGG + Intergenic
929279358 2:40061257-40061279 GTGAGGAGGAGGATTGAGGACGG - Intergenic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929444564 2:41992108-41992130 GTGGAGGAGAGGAGAGAGGAAGG + Intergenic
929458647 2:42085019-42085041 GGGAAGAAGAATAAGGAGGAGGG + Intergenic
929489519 2:42384031-42384053 GGGAAGAAGGGGATTGAGGCTGG - Intronic
929733861 2:44524566-44524588 ATGAAGATGAGGGAAGAGGAAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
929988470 2:46762845-46762867 ATGAAGAAAATGAATGAGAATGG - Exonic
930207036 2:48597945-48597967 GGGAAGGAAAGGAATGAGGGAGG + Exonic
930457668 2:51626654-51626676 GCCAAGAGGAGGAATTAGGATGG + Intergenic
930511389 2:52349727-52349749 GTGGAGGAGAGGAAGGAAGAAGG - Intergenic
930999040 2:57759388-57759410 GTGAAGTAGAGGGAGGGGGAGGG + Intergenic
931172125 2:59814612-59814634 GTGAAAAAGAGCAATGAATATGG - Intergenic
931711778 2:64993995-64994017 GGGAAGAAGAGGAATGTTTAGGG + Intronic
931838324 2:66123831-66123853 GAGGGGATGAGGAATGAGGAGGG - Intergenic
932160843 2:69458168-69458190 GTGAACAAGAGAAAGGAGGGGGG - Intronic
932498168 2:72157873-72157895 GTGAGGGAGAGGGAGGAGGATGG + Intergenic
932759256 2:74428760-74428782 GTGAGGTAGGGGAATGAGAAGGG + Intronic
932802186 2:74750730-74750752 GTGAGGAAGAGTAAAAAGGAAGG + Intergenic
932823654 2:74921701-74921723 GTGAAGAAGTGGAGAAAGGAGGG - Intergenic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934319093 2:91956086-91956108 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935536864 2:104304959-104304981 TTGAAGAAAAGGCATGAGAAGGG - Intergenic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
938600903 2:132838066-132838088 GTGAATAAGTTGAAAGAGGAGGG - Intronic
939642830 2:144661190-144661212 GTGAAGTTGAAAAATGAGGAAGG + Intergenic
939773940 2:146360976-146360998 GAGGAGAAGAGGAAAAAGGAGGG + Intergenic
939886791 2:147689916-147689938 ATGATGAAGATGCATGAGGAAGG - Intergenic
940128455 2:150354425-150354447 GTGAAGATGAGGGCTGAGAATGG + Intergenic
940337907 2:152547690-152547712 AAGAAGAAAAGGAAGGAGGATGG - Intronic
940517523 2:154699166-154699188 ATGAAGAAGAGGAAGGCAGAAGG - Exonic
940817583 2:158312814-158312836 GTGAAGAGGATGAAAGAGGATGG + Intronic
940841870 2:158593136-158593158 TAGAAGAATAGAAATGAGGAAGG + Intronic
940894240 2:159064911-159064933 GGGGAGGGGAGGAATGAGGACGG - Intronic
941234021 2:162946623-162946645 GGGAAGAAGGGGAAGGAGAAGGG + Intergenic
941293080 2:163700372-163700394 TTGAAGAAGAGAAAGAAGGAAGG + Intronic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941441735 2:165546131-165546153 GTGAAGAAGGGTATTGAGCATGG - Intronic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941751686 2:169141307-169141329 CAGAGGAAGAGGGATGAGGATGG - Intronic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
942640626 2:178057670-178057692 GTAGAGAAGAGGAATGAACAAGG - Intronic
943033914 2:182716626-182716648 GTGAATAACAGGGAGGAGGAAGG - Intronic
943173213 2:184431688-184431710 ATGTAGAAGAGGAATCAGAATGG + Intergenic
943271969 2:185817012-185817034 GTGAAGAAAGGGAAGGAGCAAGG + Intronic
943325228 2:186489647-186489669 GTACAGAAGAGGAAAGAGGTAGG - Intronic
943605000 2:189966532-189966554 GGGAAGAGGAGGCAAGAGGAAGG + Intronic
943725696 2:191249219-191249241 TTTAAGAAGAGAAATAAGGAGGG + Intronic
943900053 2:193422278-193422300 GGAAATAAGAGAAATGAGGATGG - Intergenic
945001924 2:205360973-205360995 GGGAGGGAAAGGAATGAGGAAGG - Intronic
945032746 2:205680882-205680904 GGGAGGAAGAGGAAGGAGGGAGG + Intergenic
945138831 2:206661535-206661557 GAGAAGAAGAGGGAGGAGGAGGG - Intronic
945142384 2:206700420-206700442 GGGAAGGAGAGGAGGGAGGAGGG + Intronic
945950465 2:216034532-216034554 GTGAAGGAGAGAGAGGAGGAAGG - Intronic
946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG + Intergenic
946555116 2:220847831-220847853 ATGATGGAGAGGAATGAGAAGGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946978396 2:225178439-225178461 GTGAAGAAACGGAATGAGAAGGG - Intergenic
947029911 2:225782502-225782524 GGGAAAAAAAGGAAGGAGGAAGG - Intergenic
947055922 2:226103663-226103685 GGGAAGAAGAGGAAATGGGAAGG + Intergenic
947142149 2:227029294-227029316 GTCACCAAGAGGAAGGAGGAAGG - Intronic
947348863 2:229221805-229221827 GTGGTTAAGAGGAATGGGGAGGG - Intronic
947387391 2:229605209-229605231 GTGAAGCAGAGAAACAAGGATGG + Intronic
947952002 2:234156214-234156236 GGGAAGAAAAAGAAAGAGGAGGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
947993951 2:234511575-234511597 GGTAAGAAGAGGAATGGGGGAGG - Intergenic
948033136 2:234836088-234836110 GAGAACAAGAGGAAAGAGGGTGG - Intergenic
948091917 2:235302138-235302160 AGGAAGAAGAGGAGGGAGGAGGG - Intergenic
948265522 2:236632876-236632898 GAGATGAAGAGGAGTGAAGATGG + Intergenic
1169004039 20:2192216-2192238 GTGGAGAGGAGGAAGGATGACGG - Intergenic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169323604 20:4656281-4656303 GAGAAGAAGAGAAATGAAGTGGG - Intergenic
1169345204 20:4823504-4823526 GGGAGGGAGAGGAAGGAGGAGGG - Intronic
1169651321 20:7870892-7870914 GTGGAGAAGAGGGAAGAGAAGGG - Intergenic
1169698182 20:8415540-8415562 GTGAAGCAGAGAAAGGAGAAAGG + Intronic
1170158675 20:13291194-13291216 GAGAAGAAAAGGTATGAAGAGGG - Intronic
1170369175 20:15629989-15630011 GGGAAGAAAAAGAATGAGAACGG - Intronic
1170623368 20:18012110-18012132 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
1171077036 20:22137838-22137860 GTGCAGAAGGGAAATGTGGATGG - Intergenic
1171327295 20:24305745-24305767 AGGAGGAAGAGGAATAAGGAAGG - Intergenic
1171399071 20:24860005-24860027 GTGAGGAAGAGGAACGGGGATGG - Intergenic
1172404660 20:34678926-34678948 GTGAAGAAAAGGAAACAGGCTGG + Intergenic
1172736345 20:37128709-37128731 GCGGAAAAGAGGTATGAGGAAGG - Intronic
1172778608 20:37422771-37422793 GGGCAGAGGAGGAAGGAGGAGGG - Intergenic
1172785465 20:37465465-37465487 GAGAAGAGGAGGAAGGAGGCGGG - Intergenic
1173058962 20:39643746-39643768 TTCAAGAAAAGGAATGATGATGG + Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1173979615 20:47213187-47213209 GTGATGAGGAGGACTAAGGAAGG + Intronic
1174151439 20:48489071-48489093 GTGGAGCAGAGGAATCAGAAGGG + Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174750008 20:53102468-53102490 GGGAAGAAGAGGGGAGAGGAGGG + Intronic
1175062786 20:56258927-56258949 GTGGAGAGAAGAAATGAGGAGGG + Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175130088 20:56782338-56782360 GGGAAGAAAAGGAAGGAAGAAGG + Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175452110 20:59077982-59078004 GAGAAGAAGAGGAAGGGGAAAGG + Intergenic
1176057081 20:63154662-63154684 GGGAAGAGGAGGGAGGAGGAAGG - Intergenic
1176071020 20:63226529-63226551 GGGAAGAGGAGGAAAGAGGTGGG - Intergenic
1176609954 21:8871745-8871767 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1177767540 21:25475402-25475424 GTGAAAAAGAGGAATGAGCTTGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178081754 21:29073501-29073523 CTGAAGGAAAGGAATGAGGTGGG - Intronic
1178225363 21:30710904-30710926 GAGGAGGAGAGGAAAGAGGAGGG + Intergenic
1178363923 21:31972754-31972776 GTGACAAACAGGAATGAGGAAGG + Intronic
1178882936 21:36462984-36463006 GGGAAGAAGAGGAGGGAGGGAGG + Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179346628 21:40564476-40564498 GAGAAGTAGAGGAAGGAGGAGGG - Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1179769862 21:43606423-43606445 GTGAGCAGGAGGAAAGAGGAGGG + Intronic
1180307274 22:11139753-11139775 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
1180360019 22:11880996-11881018 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1180525454 22:16254901-16254923 AGGAAGAAAAGGAAAGAGGAAGG + Intergenic
1180545794 22:16501937-16501959 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
1180621910 22:17167979-17168001 GAGATGAAGAGGAGGGAGGAAGG + Intergenic
1180749705 22:18115870-18115892 GTGAAGAGGAGGGAGGTGGAGGG - Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1180865495 22:19116561-19116583 GTGAAAGAAAGGAAAGAGGACGG + Intronic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1180938557 22:19641897-19641919 GAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1181115912 22:20632442-20632464 GAAAAGGAGGGGAATGAGGAGGG + Intergenic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1182194219 22:28497830-28497852 GTGAGGAATAGGGCTGAGGATGG + Intronic
1182322739 22:29489106-29489128 GTGAAGAAGAGGAGGCAGAAGGG + Exonic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1183034879 22:35134054-35134076 GGAAAGGAGAGGAAAGAGGAGGG + Intergenic
1183266199 22:36827339-36827361 GAGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183299545 22:37052076-37052098 GGGAAGAAGCGGCAGGAGGAGGG + Intronic
1184409702 22:44319419-44319441 GGGATGAAGGGGAAAGAGGAGGG + Intergenic
1184797009 22:46738383-46738405 GGGGAGAAGAGGGAGGAGGAAGG + Intergenic
1184907522 22:47498875-47498897 GTGAAGTGGACCAATGAGGAAGG + Intergenic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
1185201267 22:49507009-49507031 GAGAAGAAGAGGAAGGAGAAGGG + Intronic
949251823 3:1994418-1994440 GGGAAGGAGAGTAAAGAGGAAGG + Intergenic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950626442 3:14250889-14250911 GCGGAAAAGAGGGATGAGGAAGG + Intergenic
951431949 3:22618417-22618439 GTGAAGAAGAGGAAGAAAAAAGG + Intergenic
951794474 3:26523492-26523514 GTGAAGAGTAGGAAGGATGAGGG - Intergenic
952418887 3:33114003-33114025 GAGAAGGAAAGGAAAGAGGACGG - Exonic
953006892 3:38987234-38987256 GGGAGGAAGAAGAAAGAGGAGGG - Intergenic
953169613 3:40495425-40495447 AAGAAGGAGAGGAGTGAGGAGGG - Intergenic
953210362 3:40869977-40869999 GTGCAGCAGAGGACTGAGCAAGG + Intergenic
953439313 3:42904388-42904410 GAGAAGAGAAGGAAAGAGGAAGG - Intronic
953545068 3:43858294-43858316 GATAAGAAGAGGAAGGAGTATGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954290195 3:49645638-49645660 GTGAAGAAAAGCAATGCTGAAGG - Intronic
954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG + Intronic
954876403 3:53805731-53805753 GGGAAGATGAGGGAGGAGGAGGG - Intronic
954876409 3:53805751-53805773 GGGAAGATGAGGGAGGAGGAGGG - Intronic
954940174 3:54364774-54364796 GCAAAGAAGCGGAAAGAGGAAGG + Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955461151 3:59184513-59184535 GTGAAAAAAAGGAAGGAAGAAGG + Intergenic
955660650 3:61295306-61295328 GTTAAGAAGAGGATTTAGGCCGG - Intergenic
956212631 3:66817323-66817345 GGGAAGGAGAGGGAAGAGGAGGG + Intergenic
956423942 3:69113470-69113492 GTGATGAAGATGAATGCTGAAGG + Intronic
957166246 3:76677280-76677302 GAGAAGAAAAAGGATGAGGAGGG + Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957944377 3:87043931-87043953 GTGGAAAAGAGGGATGAGAAAGG + Intergenic
958774718 3:98468162-98468184 GGGAGGAAAAGGAATGTGGACGG - Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959007842 3:101040526-101040548 GTGTATCTGAGGAATGAGGAGGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959547810 3:107617921-107617943 GTGAATAAGAGTAATGAGACTGG + Intronic
959969239 3:112390197-112390219 GAGAAAGAGAGGAAAGAGGAAGG - Intergenic
960168491 3:114431143-114431165 GTACAGAAGAAGAAGGAGGAAGG + Intronic
960250239 3:115443505-115443527 GAGAAGCAGAGGAACCAGGATGG - Intergenic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
961345435 3:126260616-126260638 GGGAGGAAGAGGAGAGAGGAAGG - Intergenic
961960422 3:130848821-130848843 GTGATGAAAAGAAATGGGGAGGG - Intergenic
961993935 3:131220969-131220991 GTGAAAAAGAGGAAAGGGGTGGG + Intronic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
963299598 3:143583973-143583995 GTAATGAAGAAGAAGGAGGAGGG + Intronic
963502023 3:146139215-146139237 GTGAAAAAGAGCAGTGAAGAAGG + Intronic
963776849 3:149448493-149448515 AGGAAGAAGAGGAAGGAGAAAGG - Intergenic
964041466 3:152267216-152267238 GTGGAGAAGAGAAAAGAGCAGGG - Intronic
964527065 3:157626286-157626308 GTGTAGAAGGGCAATAAGGATGG + Intronic
965272355 3:166634878-166634900 GACAAGAAGAGAAATGGGGAGGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965687831 3:171324140-171324162 GTGAAAGAGAGGAGGGAGGAAGG + Intronic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966207663 3:177421473-177421495 AGGAAGAAGAGGAATGGGGCAGG + Intergenic
966319462 3:178685020-178685042 GAGTAGAAGAGGAAGGAGGGAGG - Intronic
966390567 3:179448775-179448797 GTGAGGTAGAGAAATGAGGCAGG + Intronic
967664887 3:192159085-192159107 AGGAAGTAGAGAAATGAGGAGGG - Intronic
967703728 3:192624458-192624480 GAGAAGAGGAGGAAGGAGAAGGG + Intronic
967973884 3:195020078-195020100 GTGAAGATGAGAGATGAGGGAGG - Intergenic
1202736640 3_GL000221v1_random:6535-6557 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
968426118 4:524499-524521 GAGAAAGAGAGGGATGAGGAGGG + Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968800275 4:2738762-2738784 TTGAGGAAGAGGTATGTGGATGG + Intergenic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969157551 4:5224573-5224595 GTAAAGAAGTGGAACCAGGAAGG - Intronic
969403457 4:6972670-6972692 GCGGAAAAGAGGGATGAGGAAGG + Intronic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970162624 4:13204658-13204680 GAGAAGGAGAGCAAGGAGGATGG - Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970512231 4:16792801-16792823 TTTAACAAGAGGAAGGAGGAAGG + Intronic
970737250 4:19187576-19187598 ATGATGAAGATGGATGAGGATGG + Intergenic
971274412 4:25182362-25182384 GTGAAGAAGAGGAGAGAGTCTGG + Intronic
971357985 4:25912259-25912281 GGGAAGAAGTAGGATGAGGATGG + Intronic
971525624 4:27613970-27613992 GAAAAGGAGAGGAAAGAGGAAGG + Intergenic
971661698 4:29426112-29426134 GAGAGGAAGAGGGAGGAGGAAGG - Intergenic
971663381 4:29449955-29449977 AGGAAGAAAAGGAAAGAGGAGGG + Intergenic
971818461 4:31521131-31521153 GTGAAGCAGAGAAATGAAAAGGG + Intergenic
972337405 4:38119731-38119753 GTCATGAAGAGGAGTGAGGATGG + Intronic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972685387 4:41347818-41347840 GTGAAGAAGAGAAGGAAGGAAGG - Intergenic
972776949 4:42250164-42250186 GTAAAGAAGAGGAGAGAGGGAGG + Intergenic
972874621 4:43343445-43343467 ATGAAGGAAAGGAAGGAGGAAGG - Intergenic
973087355 4:46082314-46082336 GAGAAGAAGAGAAATAAGGGAGG - Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973333969 4:48937331-48937353 TAGAAGTTGAGGAATGAGGATGG - Intergenic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973719763 4:53711497-53711519 GGGCAGGAGAGGAATGAGGGAGG - Intronic
973956319 4:56066891-56066913 GTCTAGAAGAGGAAAGAAGATGG + Intergenic
974063458 4:57055719-57055741 GTCAAGGGCAGGAATGAGGAGGG - Intronic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
974294292 4:59975803-59975825 GTGAAGAAGATGAATGTGAGTGG - Intergenic
974373852 4:61051042-61051064 CTGAAGAAAAGGCATGTGGATGG - Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975082404 4:70296897-70296919 GTGAGGCAGAGGCATGAGAATGG - Intergenic
975228950 4:71908177-71908199 GTGAATAAAAGGGAGGAGGAAGG + Intergenic
975820117 4:78262261-78262283 GTGATGAAAAGCAGTGAGGAAGG - Intronic
976161769 4:82208964-82208986 GGGAAGAAAAGGGAAGAGGAAGG + Intergenic
976296315 4:83475960-83475982 GGGAAGCAGAGGAAGGAGGACGG + Intronic
976888865 4:90020466-90020488 CAGAAGAAGAGGGATTAGGAAGG - Intergenic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
977805155 4:101288592-101288614 GGGAAGGAGGGGAAGGAGGAAGG + Intronic
978101502 4:104847153-104847175 GTGAAGAAGAGAAATGGCAATGG + Intergenic
978400969 4:108330351-108330373 GGGAAGAGCAGGAAGGAGGAGGG - Intergenic
978420827 4:108531127-108531149 ATGAGGCAGAGGAATGAGGGAGG + Intergenic
978546553 4:109876953-109876975 GGGAAGGAGAGGAGAGAGGAGGG - Intergenic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
978971765 4:114816130-114816152 GTAAGGAAGAGGAATGGGCAAGG - Intergenic
979343525 4:119557266-119557288 GTTAAGGAGAGGAAGAAGGAAGG - Intronic
979396502 4:120196052-120196074 GGGAAGAAGAGGAATAAGTGTGG + Intergenic
979480776 4:121214447-121214469 GTGGAGAAGAGGCAAGAGAATGG + Intronic
979712994 4:123802847-123802869 GGGAAGAAGAGGAAGGAAGACGG - Intergenic
980113663 4:128658773-128658795 GGGAAGAAGAGGAGTGGGGCAGG + Intergenic
980385700 4:132086407-132086429 TTGAGGAAGAGGTATGTGGATGG - Intergenic
980411312 4:132423150-132423172 GGGTAAAAGAGGAATGAGGTAGG + Intergenic
980801077 4:137751107-137751129 GTGAAGAAGAGTATGAAGGAGGG - Intergenic
980868835 4:138586814-138586836 GAGATGAAGAGGAATGAAGGAGG + Intergenic
981023054 4:140048926-140048948 GTGAAGAGGAAGAATGAACAGGG + Intronic
981121666 4:141058285-141058307 GGGATGAAGAGGAGTGGGGAGGG + Intronic
981205908 4:142040117-142040139 GGGAAGAAGAGGAGGGAGGAAGG + Intronic
981454758 4:144940567-144940589 CGGTAGAATAGGAATGAGGATGG - Intergenic
981614192 4:146629481-146629503 AGGAAGAAGGGGAATAAGGAAGG + Intergenic
982146457 4:152400001-152400023 CTGAAGGAGAGGAATGAAGCTGG + Intronic
982369909 4:154623704-154623726 CTGAAGAAGAGGAATCAGAGAGG - Intergenic
983777097 4:171621820-171621842 GTGAAGGAGAGTCATGAGAAAGG - Intergenic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
983922089 4:173357110-173357132 GTGGAGATTAGGATTGAGGAAGG + Intergenic
984456627 4:179977438-179977460 GGGAAGAAGAGGAATAGAGAGGG - Intergenic
984671196 4:182489838-182489860 GGGAAGAAAAGGAAGGAGGGAGG - Intronic
984753199 4:183298544-183298566 GTGAGGGAAAGGAATGGGGAAGG - Intronic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
985117419 4:186605499-186605521 GGGAAGAGGAGGAGTGGGGAGGG + Intronic
985362578 4:189191537-189191559 GTTCACATGAGGAATGAGGATGG + Intergenic
985427367 4:189843889-189843911 GGGAAGAAGGGAAATGAGCAAGG - Intergenic
1202769294 4_GL000008v2_random:186734-186756 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986025663 5:3848044-3848066 TTGACGAAGAGGTATGTGGATGG + Intergenic
986132855 5:4946890-4946912 TTGAAGAAGAGGAACAAGAAAGG - Intergenic
986536465 5:8793371-8793393 GGGAAAAAGAGAACTGAGGATGG + Intergenic
986656724 5:10020186-10020208 TTGTAAAATAGGAATGAGGATGG + Intergenic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
986741981 5:10712508-10712530 GTGCAGAGGAGGACTGAGCACGG + Intronic
986770461 5:10968215-10968237 GTGAAGGAGAAGATGGAGGAAGG - Intergenic
987068204 5:14309840-14309862 GAGAAGAAAGGGAATAAGGAAGG - Intronic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
987518598 5:18948220-18948242 GAGAAGAAGAAGAAGAAGGAGGG + Intergenic
987665601 5:20935040-20935062 GTAAAGAACAGGAGTGTGGATGG + Intergenic
987694490 5:21310560-21310582 GTGAAGAATAGGAAAGGGGGAGG - Intergenic
987729672 5:21752806-21752828 AGGAAGTAGAGGAAGGAGGAAGG + Intronic
987938444 5:24500901-24500923 GAGAAGAAGTGGAGAGAGGAGGG + Intronic
988562973 5:32297498-32297520 GTGAAGAAAAGGATTTAGAATGG - Intronic
988612182 5:32737152-32737174 GTGAGGAAGAGGCATTAGAAAGG - Intronic
988779018 5:34502480-34502502 GAGAAGGAGGGGAGTGAGGATGG - Intergenic
988841355 5:35086948-35086970 GAGAAGATGGGGAAAGAGGAAGG - Intronic
989380618 5:40806395-40806417 GTGAAGTAGAGCAATGAATATGG + Intergenic
989549383 5:42715884-42715906 GTCATTAGGAGGAATGAGGATGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991745750 5:69738911-69738933 GTGAAGAATAGGAAAGGGGGAGG + Intergenic
991751956 5:69816322-69816344 GTGAAGAATAGGAAAGGGGGAGG - Intergenic
991797350 5:70318869-70318891 GTGAAGAATAGGAAAGGGGGAGG + Intergenic
991825128 5:70614225-70614247 GTGAAGAATAGGAAAGGGGGAGG + Intergenic
991831243 5:70691223-70691245 GTGAAGAATAGGAAAGGGGGAGG - Intergenic
991889694 5:71318196-71318218 GTGAAGAATAGGAAAGGGGGAGG + Intergenic
992353683 5:75957134-75957156 CTGAGGAAGAGCAATGATGATGG + Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992467595 5:77022481-77022503 GAGAAGAAGAAGAAAGAGAAGGG + Intergenic
992530027 5:77644841-77644863 GAGAAAAAGAGAAAGGAGGAAGG - Intergenic
992724286 5:79590989-79591011 GTGAAGCTGAGGTATGAGGCAGG + Intergenic
993880348 5:93353406-93353428 GTGCAGCAGAGGTATGATGAGGG + Intergenic
993903454 5:93599276-93599298 GTGAAAAGGAGGAAGGAAGAAGG + Intergenic
993955082 5:94222346-94222368 GAAAAGAAGAGGAGAGAGGATGG + Intronic
994291282 5:98031321-98031343 GTGGGGAAGAGGTATGTGGATGG - Intergenic
994310275 5:98261313-98261335 ATGAGGATCAGGAATGAGGAGGG + Intergenic
995002778 5:107155284-107155306 GTTAAATAGAGGAATGAGGTAGG - Intergenic
995060862 5:107810416-107810438 CAGAAGCTGAGGAATGAGGATGG + Intergenic
995069676 5:107904955-107904977 GGGAAGCAGAGGGAAGAGGAGGG + Intronic
996055113 5:118973953-118973975 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
996084643 5:119292117-119292139 GTGAAGCAGAGGCTTTAGGATGG + Intronic
996224672 5:120977322-120977344 GTAAAGAAGAGCAAGGAGGCCGG + Intergenic
996318552 5:122188600-122188622 TTTAAGAACAGGAATGAGCAAGG + Intergenic
996524205 5:124460621-124460643 CTGAAGAACAGGAATGGGGTGGG - Intergenic
996595136 5:125192253-125192275 GTGAAGTGGAGCACTGAGGAAGG + Intergenic
998430397 5:142065325-142065347 GTGAGGAAGTGAAATGAGGGTGG + Intergenic
998899620 5:146839093-146839115 ATGAAGAAGAGTATTTAGGAAGG - Intronic
999482320 5:151960031-151960053 GTGAAAAAGAGGGATGAGGGAGG + Intergenic
999937964 5:156508475-156508497 TTGAAGGTGTGGAATGAGGACGG - Intronic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000518598 5:162271787-162271809 GTGAAGAAATGGCATGAAGAAGG + Intergenic
1000909791 5:167008037-167008059 GTAGAGAAGAGGAACGGGGAAGG - Intergenic
1001155166 5:169266407-169266429 CTGAAGAAAAGGAATGTGGGTGG + Intronic
1001490458 5:172151073-172151095 GTGAAGGAGAGGCACGATGAAGG + Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001667375 5:173444573-173444595 GAGAAGAAGAGACCTGAGGAGGG + Intergenic
1001817085 5:174678692-174678714 GCCAAAAAGAGGGATGAGGAAGG + Intergenic
1001831059 5:174789795-174789817 GTGTATAGGAGGAATGAGAATGG + Intergenic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002189101 5:177469662-177469684 GGGAGGAGGAGGAAGGAGGAAGG - Intronic
1002347445 5:178557755-178557777 GGGAAGAATAGGAATGAGTTAGG + Intronic
1002624479 5:180515601-180515623 TTGAAGTTGAGAAATGAGGAGGG + Intronic
1002923004 6:1586482-1586504 GAAAACAAGAGGAAGGAGGAAGG - Intergenic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003412137 6:5875011-5875033 TAGAACAAGAGGAATGAGAATGG + Intergenic
1003630625 6:7783099-7783121 GTGAAGGAGAGGAGAGAGAAAGG + Intronic
1004005296 6:11632531-11632553 GGGGAGAACATGAATGAGGATGG - Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004176895 6:13347926-13347948 GTGAAGAGGAGTCAGGAGGAAGG + Intergenic
1004182439 6:13392753-13392775 GAGAAGAAGAGAAATAAGAAGGG + Intronic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1005397845 6:25402032-25402054 GAAAAGAAGAGAAATTAGGAAGG - Intronic
1005492741 6:26361691-26361713 GTGAAGAAAAGCAATGAGGCTGG + Intergenic
1005496905 6:26395812-26395834 GTGAAGAACAGCAATGAGGCTGG + Intergenic
1005952315 6:30641161-30641183 GTGAGGAAGAGGAAGGAGTGGGG - Intronic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006151602 6:31992955-31992977 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006157903 6:32025693-32025715 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006320865 6:33318664-33318686 GGGAAGCAGATGACTGAGGAAGG - Exonic
1006556507 6:34871653-34871675 GTGCTGAAGAGGAGTGATGATGG + Exonic
1006598859 6:35212917-35212939 GGGAAGCAGAGGAAAGAGAAAGG - Intergenic
1006609444 6:35285040-35285062 AGGAAGAAGAGAAATGAGAAAGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006977533 6:38117291-38117313 GTGAGGCAGAGGCAGGAGGATGG - Intronic
1007264969 6:40589014-40589036 GAGAAGGAAAGTAATGAGGAAGG + Intergenic
1007515327 6:42406281-42406303 GAGATGAAGAGGGAAGAGGAAGG - Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007877275 6:45119393-45119415 GGGAAGAGAAGGTATGAGGACGG + Intronic
1007925045 6:45643644-45643666 GAGAAGGCGAGGAAGGAGGAGGG - Intronic
1008047984 6:46871391-46871413 TGGGAGAGGAGGAATGAGGAAGG + Intronic
1008484569 6:52021763-52021785 GAGAAGGAGGGGAAGGAGGAGGG - Intronic
1008800492 6:55362978-55363000 AGGAAGAAGAGGAAACAGGAAGG + Intronic
1008863258 6:56176978-56177000 GGGAGGAAGAGGGAGGAGGAAGG + Intronic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009530548 6:64808035-64808057 GGGAAGAAGGGAAAGGAGGAAGG - Intronic
1009585024 6:65589329-65589351 CTGAAGAAGAGCACTGAGTAAGG - Intronic
1010398564 6:75421567-75421589 GTGAGGAGGAGTAGTGAGGAAGG - Intronic
1010752498 6:79631247-79631269 GGGAAGGAGAGGGAGGAGGAGGG - Intergenic
1010863754 6:80946829-80946851 TTGAAGTAGATAAATGAGGAAGG - Intergenic
1011224311 6:85090160-85090182 GTGAACAAGAGAAGTGAGGCTGG - Intergenic
1011656531 6:89557016-89557038 GGGAAGAAGAGAAATGGGGGAGG + Intronic
1011865899 6:91826561-91826583 GTTGAGTAGAGGAAGGAGGAAGG - Intergenic
1011915495 6:92500727-92500749 GGGAAGAAGAGGAGAGAGAAAGG + Intergenic
1012044359 6:94250871-94250893 GTGAAAAAGTGGAATAAAGATGG - Intergenic
1012421440 6:99070155-99070177 GTGAAGAAAAGGAATGGAAAAGG - Intergenic
1012580320 6:100860993-100861015 GTGAAGAAGGTGGATGAGAAAGG + Intronic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1012910021 6:105107775-105107797 TTGAAGAATGGGAATGTGGAAGG + Intronic
1012975170 6:105772944-105772966 GTGGAGGAGAGTAGTGAGGATGG + Intergenic
1013272924 6:108559835-108559857 GGGAGGAGGAGGAATGTGGAAGG + Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1014371139 6:120609014-120609036 GGGTAGAACTGGAATGAGGAAGG - Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014883765 6:126754951-126754973 CTGAACAAGAGGAAAGAGAATGG + Intergenic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015233962 6:130949589-130949611 GGGAAGAGGAGGGAAGAGGAGGG + Intronic
1015270568 6:131333854-131333876 GTGGAGAAGAGGACTGTGGTTGG + Intergenic
1015389699 6:132667762-132667784 GGGATGAACAGGAAAGAGGAAGG - Intergenic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1015506777 6:133996719-133996741 GTGAACTTGAAGAATGAGGAAGG - Intronic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1016063656 6:139656128-139656150 GGGAAGAAAAGGAGAGAGGAAGG - Intergenic
1016989388 6:149918837-149918859 GTGAGGAAGAGGAGTCAGGAGGG + Intronic
1016993744 6:149946837-149946859 GTGAGGAATAGGAGTCAGGAGGG - Intronic
1016998638 6:149979255-149979277 GTGAGGAAGAGGAGTCAGGAGGG - Intergenic
1016999752 6:149988555-149988577 GTGAGGAAGAAGAGTCAGGAGGG + Intergenic
1017004586 6:150020699-150020721 GTGAGGAATAGGAGTCAGGAGGG + Intronic
1017006864 6:150033719-150033741 GTGAGGAAGAAGAGTCAGGAGGG - Intergenic
1017011253 6:150065172-150065194 GTGAGGAAGAGGAGTCAGGAGGG + Intronic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017127808 6:151081914-151081936 GGGAAGAGGAGGAAGCAGGAAGG - Intronic
1017300794 6:152855482-152855504 GTGAGGGAGAGGAGTGAGGATGG + Intergenic
1017602073 6:156094650-156094672 GAGAAGTAGGGGAAGGAGGAAGG - Intergenic
1017607803 6:156151986-156152008 CTGAAGGTGAGGCATGAGGAAGG - Intergenic
1017608268 6:156156323-156156345 GTGAAGAAGAGGAAGACAGAGGG + Intergenic
1017635743 6:156441534-156441556 GAGAAGAAGAGGAATGAAGCAGG + Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018078704 6:160239949-160239971 GGGAAGAAAAGGAATGAGCAGGG + Intronic
1018479514 6:164175585-164175607 GAAAAGGAGAGGAATGAGGCTGG + Intergenic
1018907652 6:168084826-168084848 GTGATGGGGAGGAATGAGGTGGG - Intergenic
1019159114 6:170057688-170057710 GGGAGGGAGAGGAATGAGGAGGG - Intergenic
1019551879 7:1607086-1607108 GAGAGAAAGAGGAAAGAGGAGGG - Intergenic
1019776114 7:2913003-2913025 GGGAAGAAGAGGGAGGAGGGAGG + Intronic
1020011458 7:4807886-4807908 GAGAAGAAGAGGGAAGAGGGAGG - Intronic
1020050330 7:5077052-5077074 AGGAAGAAAAGGAAGGAGGAAGG - Intergenic
1020372906 7:7453853-7453875 CTGAAGAAGAGGAAAAGGGAAGG - Intronic
1020690291 7:11346671-11346693 GTGAAGAAGAGAAGAGAGGAGGG - Intergenic
1020800922 7:12731201-12731223 GAGGAGACGAGGAATGAGGAGGG - Intergenic
1021428278 7:20529151-20529173 GAGACCAAGAGGAATGAGGTGGG - Intergenic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1021798487 7:24281807-24281829 GTGAGGAAGAGGCAAAAGGAAGG + Intergenic
1022015417 7:26345012-26345034 GTGAAGACGAAGACGGAGGAGGG - Intronic
1022096161 7:27142878-27142900 AAGAAGAGGAGGAAGGAGGAAGG + Intronic
1022300148 7:29095309-29095331 GTAAAGGAGAGGAGTGGGGAGGG - Intronic
1022318518 7:29266274-29266296 ATGAAGAAGAGGGAGGAGGGAGG - Intronic
1022346484 7:29520169-29520191 TTGAAGAAGAGGAACAAGAATGG - Intergenic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1022374047 7:29796945-29796967 GTGGAGAAGAGTTAGGAGGAGGG + Intergenic
1022617386 7:31945767-31945789 CTGAAGGAGAGGAAAGAGAATGG - Intronic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023224605 7:37956105-37956127 GTGAAGAAGAAGGAGCAGGAAGG + Intronic
1023305825 7:38825892-38825914 CTGATGCAGAGAAATGAGGACGG + Intronic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1023856289 7:44186124-44186146 GCTCAGAAGTGGAATGAGGATGG - Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024203888 7:47135455-47135477 GAGAAGAAAAGGAAAGAGGAAGG - Intergenic
1024270156 7:47635826-47635848 GGAAAGAAGAGGAGGGAGGAAGG + Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1024957002 7:54932989-54933011 GTGAAGGAGGGAAGTGAGGATGG + Intergenic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025198673 7:56949331-56949353 GGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1025673276 7:63627600-63627622 GGGAGGAGGAGGAAGGAGGAGGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026479686 7:70766732-70766754 GTGAAGAAGAGAGAAGAGAAGGG + Intronic
1026638776 7:72106565-72106587 GAGAAAAAGAGGAAGGTGGAAGG + Intronic
1028051537 7:86193946-86193968 GTGAAGAGAAGGAGGGAGGAAGG + Intergenic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028285177 7:88987901-88987923 GGGAAGAAAAGGGAGGAGGAGGG - Intronic
1028285189 7:88987969-88987991 GAGAAGAAAAGGAAGGAGGAGGG - Intronic
1028291709 7:89074051-89074073 GTAAAGATGAGAAATGGGGAAGG + Intronic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028387224 7:90269756-90269778 GTGAAGAAAAAGAAAGAAGATGG + Intronic
1028619717 7:92811812-92811834 CTGAAGGAGAGGAATAAGTAAGG + Intronic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1028797907 7:94925761-94925783 GGGGAGAAGAGGAAGGAGAAAGG - Intronic
1029080732 7:97972123-97972145 GGGAAGGAGAGGTATGCGGAGGG - Intergenic
1029184482 7:98728781-98728803 GAGAAGGAGAGGAAGGAGGGAGG - Intergenic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029622276 7:101697714-101697736 GTGAAGGTCCGGAATGAGGAAGG + Intergenic
1029630473 7:101747228-101747250 GCGGAAAAGAGGGATGAGGAAGG - Intergenic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1029869155 7:103670599-103670621 GTGAAGAATGGGAATTAGCATGG + Intronic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030403405 7:109081046-109081068 AGGAAGAAGAGGTGTGAGGAGGG + Intergenic
1030814754 7:114022439-114022461 GTGCAGATGATGAATGATGAGGG - Intronic
1031041162 7:116839782-116839804 ATGAGGAAGAGGAAAGATGAGGG + Intronic
1031056223 7:116995636-116995658 CTGAATAGCAGGAATGAGGAAGG - Intronic
1031083759 7:117282447-117282469 GAGGAGGAGAGGAAGGAGGAGGG + Intronic
1031488886 7:122363852-122363874 GTGACAAAGAGGAATGAGTTTGG + Intronic
1031570241 7:123350222-123350244 GTGAGGAAGAGTAGTGAGGAGGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032065778 7:128769300-128769322 GAGAGGAGGAGGAATGGGGACGG - Exonic
1032340872 7:131071560-131071582 GTGATGTAAAGGAATGAGCATGG - Intergenic
1032430705 7:131859041-131859063 GTGAACCAGAGGAAGGAAGAGGG + Intergenic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1032669396 7:134069408-134069430 GAGAAGAGGAGGAAGGAGGAAGG - Intergenic
1033649393 7:143329388-143329410 CTGAAGAGGAGGATTGGGGATGG + Intronic
1033659508 7:143393842-143393864 GTTATGAAGAGCATTGAGGATGG - Exonic
1033683407 7:143618720-143618742 GGGGAAAAGAGGGATGAGGAAGG + Intergenic
1033701206 7:143838918-143838940 GGGGAAAAGAGGGATGAGGAAGG - Intergenic
1033804207 7:144936446-144936468 ATGAGGAAGAGGAATGTGGGTGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034214699 7:149396381-149396403 GTGAAGAAGACGAGTAGGGAAGG + Intergenic
1034218813 7:149428800-149428822 CTTAGGAAGAGGCATGAGGAGGG + Intergenic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034492515 7:151401400-151401422 GGGAAGGAGAGGAGGGAGGAAGG - Intronic
1035280697 7:157776360-157776382 GTGAGGAAGAAGAGAGAGGAGGG - Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035883193 8:3265612-3265634 GTGAAGGAGAGGAGTGAAGGTGG + Intronic
1035978413 8:4339703-4339725 GAGAAGAAAATGAAAGAGGACGG + Intronic
1036651603 8:10647485-10647507 GGGGAGAGGAGAAATGAGGATGG - Intronic
1036658135 8:10690823-10690845 GAGGAGGAGAGGAATGAGGAGGG - Intronic
1037219779 8:16504607-16504629 TTGAAGAAAAGGAAAGGGGAAGG + Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1038057360 8:23873201-23873223 GTGAAAAAGATTAATGAGGCCGG - Intergenic
1038353408 8:26803093-26803115 GTGAAGATGGGAAATGGGGATGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038483763 8:27919277-27919299 GTGAAGGAGGAGGATGAGGAGGG + Intronic
1038547685 8:28438379-28438401 AAGAAGAAGAGAAATGGGGACGG + Intronic
1038652918 8:29421983-29422005 TTGAAGGAAAGGAATGTGGAGGG + Intergenic
1038929685 8:32178825-32178847 GTGAAGAAGAGGGAGGAGTCAGG + Intronic
1039129202 8:34242505-34242527 GAGAGGAAGAGAGATGAGGAGGG + Intergenic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039378923 8:37066820-37066842 GGGAAGAAGAGGATGGAGGAGGG + Intergenic
1039600530 8:38833243-38833265 GCGGAAAAGAGGGATGAGGAAGG + Intronic
1039623683 8:39025396-39025418 GTGAACATGAGGAGTAAGGATGG - Intronic
1039920797 8:41893072-41893094 GTGAAGCAGAGGATAGAAGAGGG - Intronic
1040835227 8:51723955-51723977 GTGGAGAAGAGGAAATAAGATGG + Intronic
1040835237 8:51724013-51724035 GTGCAGAAAAGGAAAGAGGGAGG + Intronic
1040855583 8:51945317-51945339 AGGAAGAAAGGGAATGAGGAGGG - Intergenic
1041130269 8:54691610-54691632 GAGAAGAAGAGGCATGAGAACGG + Intergenic
1041419529 8:57650920-57650942 GGTAAGAAGAGAATTGAGGATGG - Intergenic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042602164 8:70509845-70509867 GTGAAGAAGAGCAAAGTTGAAGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043566166 8:81550620-81550642 GTAAAGTAGGGGAATAAGGAAGG + Intergenic
1043800260 8:84600682-84600704 ATGACTGAGAGGAATGAGGAGGG + Intronic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044402237 8:91786161-91786183 GGGAAGAAGGGGAAGGAGAAGGG - Intergenic
1044429429 8:92091154-92091176 TTGTAGAAGAGGAATGCAGAGGG - Intronic
1044487073 8:92766553-92766575 TTGCAGAAGAGGTATGTGGATGG - Intergenic
1044707424 8:95022318-95022340 GAGAAAAAGAGTAATGAAGAAGG + Intronic
1044871559 8:96625329-96625351 GAGGACAAGAGGAGTGAGGAAGG - Intergenic
1045025579 8:98083627-98083649 GTGAGGAGGGGAAATGAGGAGGG - Intronic
1045345173 8:101287603-101287625 TTCAAGAAGAGGAAAGAGCAGGG - Intergenic
1045538334 8:103056819-103056841 GTAAAGAAGTGGAATTAGTAAGG + Intronic
1045863623 8:106840267-106840289 GTGAATCATAGCAATGAGGATGG - Intergenic
1046574571 8:116010923-116010945 GGGAAGAAGTGCAATGTGGATGG + Intergenic
1046870825 8:119204382-119204404 GGGAAGAAGGGGATGGAGGAGGG + Intronic
1046957898 8:120080674-120080696 GTGAAGAAGAGAAAGAGGGAAGG + Intronic
1047567714 8:126063679-126063701 GTCAAGAGGAGGAAAGAGCATGG - Intergenic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1047852836 8:128877560-128877582 GTGGAGGAGAGGCAGGAGGAGGG + Intergenic
1048064489 8:130953764-130953786 GTGAAGTAGAGGTGAGAGGAGGG - Intronic
1048288905 8:133164674-133164696 GTGAGGAAGGGGAATTAGGCAGG - Intergenic
1048290522 8:133177941-133177963 GTGAAGGAGAGGATTGGAGAGGG - Intergenic
1048296440 8:133218052-133218074 GTGAAGGAGGGGACAGAGGAAGG - Intronic
1048680475 8:136835948-136835970 TTCAAGCAGAGGAAGGAGGAGGG - Intergenic
1049026036 8:139989581-139989603 GAAAGGAAGGGGAATGAGGAAGG - Intronic
1049198895 8:141330311-141330333 GAGAAGAAGAGGAAGAGGGAAGG - Intergenic
1049469240 8:142768140-142768162 GGGGAGAAGAGGAGAGAGGAAGG + Intronic
1049604903 8:143524755-143524777 GGGAACAAGAGGAATAGGGAGGG + Intronic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050139703 9:2504545-2504567 CTGAAGAAGAGGTAGGACGAAGG - Intergenic
1050359922 9:4820213-4820235 TTGAAGAAGAGGAGTCAGCAGGG + Intronic
1050396671 9:5205170-5205192 GTGATCAAGAGGAAAGTGGAGGG - Intergenic
1050475917 9:6040967-6040989 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050625816 9:7502603-7502625 GTGAAGTAGAATTATGAGGAAGG + Intergenic
1050855752 9:10352384-10352406 AAGAAGAATAGGAATGAGAATGG - Intronic
1050901868 9:10960262-10960284 TTGAGGAAGAGGTATGTGGATGG + Intergenic
1051144420 9:14011096-14011118 GTTTAGAACAGGAATTAGGAAGG - Intergenic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051475467 9:17503415-17503437 GTGAAGAGGTGAAATGAGGTGGG - Exonic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1051951650 9:22641928-22641950 GTGAAGCAGGGGAACCAGGACGG + Intergenic
1052323424 9:27192669-27192691 GGGAGGAAGGGGAAAGAGGAAGG + Intronic
1052368736 9:27641465-27641487 GTGAGGAAGAGGTATGTGGATGG + Intergenic
1052842125 9:33301055-33301077 CTGAGGAAGAGGATTTAGGAAGG - Intronic
1052850177 9:33373425-33373447 GTGAGGAAGGCTAATGAGGAAGG - Intergenic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1052961139 9:34298075-34298097 GGGAAGAAGAGGAATTTGAAAGG + Intronic
1053095595 9:35325250-35325272 GTTGTGAAGAGGAATGAGGGGGG + Intronic
1053163205 9:35827936-35827958 GTGAGGAAGGGGAAAGAGAAGGG + Intronic
1053480545 9:38413430-38413452 GGGAGGAGGAGGAAGGAGGAGGG - Intronic
1053568762 9:39281847-39281869 GTGAAGATAAGGAATGGGGAGGG - Intronic
1053834731 9:42122878-42122900 GTGAAGATAAGGAATGGGGAGGG - Intronic
1054090397 9:60840812-60840834 GTGAAGATAAGGAATGGGGAGGG - Intergenic
1054111808 9:61116369-61116391 GTGAAGATAAGGAATGGGGAGGG - Intergenic
1054128382 9:61337160-61337182 GTGAAGATAAGGAATGGGGAGGG + Intergenic
1054360419 9:64108905-64108927 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1054595808 9:67064650-67064672 GTGAAGATAAGGAATGGGGAGGG + Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054723856 9:68630629-68630651 GTGAAGGAGAAAAAGGAGGAGGG + Intergenic
1054936254 9:70691930-70691952 GAGGAAAAGAGGGATGAGGAAGG - Intronic
1054946886 9:70805180-70805202 GAGAGGCAGAGGAAGGAGGAGGG + Intronic
1055043599 9:71901706-71901728 TTGAATGAGAGGAATGAAGAGGG - Intronic
1055263692 9:74471159-74471181 AGGAAGAAGAGGAGTGATGAAGG + Intergenic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1055757433 9:79571566-79571588 TTAACGAAGAGGAATGAGGTTGG - Intergenic
1055903851 9:81270563-81270585 GTGAGGAGGAGGTATGTGGATGG - Intergenic
1056335995 9:85569565-85569587 GTAAATAAGGGGAATGAGGGAGG - Intronic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056559936 9:87721481-87721503 GAGAAGAGGAGGGATGAGGCTGG - Intergenic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1056831019 9:89917684-89917706 TTGAAAATGAGGAATGTGGATGG - Intergenic
1056849513 9:90070482-90070504 TTGAAGAAGAGCATGGAGGATGG + Intergenic
1056878272 9:90360244-90360266 TTGAAAATGAGGAATGAGGTGGG - Intergenic
1057298783 9:93864709-93864731 GGGTAGAAAAGGAAGGAGGAGGG - Intergenic
1057576661 9:96247599-96247621 GGGAAGAAGAGGGAGGATGAGGG + Intronic
1058407355 9:104691702-104691724 TTGAAGTAGAGGAAAGTGGAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058665767 9:107313945-107313967 GGGAAGAAAGGGAAGGAGGAAGG - Intronic
1058766083 9:108184086-108184108 GTGGGGAAGAGTAATGAGGCCGG - Intergenic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059632220 9:116136840-116136862 GAGAAGAAGAGGAAAGAGAGAGG + Intergenic
1059691324 9:116688003-116688025 GTGCATAAGAGGAAGGAGCAGGG + Intronic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1060202708 9:121661054-121661076 GTGAAGAAGCGGGAGGATGAGGG + Intronic
1060325458 9:122610240-122610262 GTGAGGAGGAGGCATGACGAGGG - Intergenic
1060679885 9:125553119-125553141 TGGAAGATGAGGAGTGAGGAGGG - Intronic
1060976855 9:127770176-127770198 GGGATGAAGAGGAAGGAGGGAGG - Intronic
1061274965 9:129564724-129564746 GGGAAAAACAGGACTGAGGATGG + Intergenic
1061313244 9:129777616-129777638 GGGAAGAGGAGGAGGGAGGAGGG - Intergenic
1061360453 9:130138543-130138565 GGGAAGAGGAGGGAGGAGGAGGG - Exonic
1203694182 Un_GL000214v1:80450-80472 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
1203705372 Un_KI270742v1:36975-36997 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1203558637 Un_KI270744v1:28830-28852 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
1203642091 Un_KI270751v1:23613-23635 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1185492335 X:527210-527232 AGGAAGAAAAGGAATAAGGAAGG - Intergenic
1185492357 X:527326-527348 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492363 X:527391-527413 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492369 X:527456-527478 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492374 X:527521-527543 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492380 X:527586-527608 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492387 X:527653-527675 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492394 X:527720-527742 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492401 X:527787-527809 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492408 X:527854-527876 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492415 X:527921-527943 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492422 X:527988-528010 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492429 X:528055-528077 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492436 X:528122-528144 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492447 X:528221-528243 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492453 X:528288-528310 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492460 X:528355-528377 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492466 X:528422-528444 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492473 X:528487-528509 AGGAAGAAAAGGAATAAGGAAGG - Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185969118 X:4642133-4642155 GGGAAGATGAGGCAGGAGGATGG + Intergenic
1186303421 X:8227137-8227159 ATGAAGGAGAGGAGGGAGGAAGG - Intergenic
1186399332 X:9242236-9242258 GTGACTAGAAGGAATGAGGAAGG - Intergenic
1186470559 X:9818761-9818783 GTGAAGAAAAAGAAAGAAGAGGG - Intronic
1187013432 X:15302898-15302920 GGGAAGAGGAGGGAAGAGGAGGG + Intronic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187270335 X:17774990-17775012 GAGCAGAAGAGGTGTGAGGATGG - Intergenic
1187320173 X:18230718-18230740 GAGCAGAAGAGGTGTGAGGATGG + Intergenic
1187347101 X:18475534-18475556 GGGAAGCAGAGGCAGGAGGATGG - Intronic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188236630 X:27739729-27739751 GTGAGGATTAGGGATGAGGATGG - Intronic
1188519288 X:31020108-31020130 CTGAAGAGGAGGAATAAGGAGGG + Intergenic
1188874925 X:35417881-35417903 GTGAAAAAGAGGTATGTGGCAGG + Intergenic
1188926830 X:36054099-36054121 GTGAAGAACAGCAACCAGGAAGG - Intronic
1189058542 X:37727180-37727202 TGGAAGAAGAGAAATGAGGCAGG + Intronic
1189110578 X:38286035-38286057 GGGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110605 X:38286107-38286129 GGGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110615 X:38286134-38286156 GGGAAGAGGAGGAAGGAGAATGG - Exonic
1189110632 X:38286182-38286204 GGGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110652 X:38286242-38286264 GAGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110667 X:38286293-38286315 GAGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110682 X:38286344-38286366 GGGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110711 X:38286431-38286453 GGGAAGAGGAGGAAGGAGAAGGG - Exonic
1189141962 X:38616532-38616554 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1189321167 X:40088457-40088479 GGGAAAAAGAGGGAGGAGGAGGG + Intronic
1189437567 X:41006478-41006500 GTGAGGCAGAGGCAGGAGGATGG - Intergenic
1189779666 X:44502055-44502077 GGGAAGAGGAGGCCTGAGGAGGG - Intergenic
1189947082 X:46190468-46190490 GAGAAGAAGGGGGATGAGGAGGG - Intergenic
1189947099 X:46190572-46190594 GAGAAGAAGGGGGATGAGAAGGG - Intergenic
1190128385 X:47725124-47725146 GTGAAGGAGAGGAGGGTGGAGGG - Intergenic
1190789045 X:53682856-53682878 CTGAGGGGGAGGAATGAGGAAGG + Intronic
1190913434 X:54792195-54792217 GAGAAGAAGAGGAAAGGAGAGGG + Intronic
1190936821 X:55005223-55005245 ATGCATAAGAGGAATGAGGCAGG - Intronic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1191097875 X:56693339-56693361 GTGAAGATGAGGAAAGAGAGTGG - Intergenic
1191592065 X:62897282-62897304 GTGGAGATGGGGAATGATGAGGG + Intergenic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1191719155 X:64215085-64215107 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1192093346 X:68184223-68184245 GTCAAAAAGAGGAATGGGGCCGG + Intronic
1192153418 X:68725985-68726007 GTCCACAAGAGGAATGGGGAGGG + Intergenic
1192191485 X:68994019-68994041 GTGAGGATGAGGGAAGAGGATGG + Intergenic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192471048 X:71399042-71399064 GGGAAGCAGAGGTAGGAGGATGG - Intronic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193904561 X:87226445-87226467 TTGAAGAAGAGGTATATGGATGG + Intergenic
1193975864 X:88118194-88118216 GAGAAGAAGAGAAAAGTGGAGGG - Intergenic
1194154414 X:90369661-90369683 CAAAAGAGGAGGAATGAGGAAGG - Intergenic
1195870556 X:109480988-109481010 GGGAAGAAGAGAAAGAAGGAAGG + Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196124221 X:112082344-112082366 GTGAAGGAGAGGGAGAAGGAGGG + Exonic
1196135877 X:112209213-112209235 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1196657333 X:118232206-118232228 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1196981616 X:121220659-121220681 GTGAAGAAGATGAAGAATGAGGG - Intergenic
1197100151 X:122643789-122643811 GTGAGGAACAGGATTTAGGAGGG - Intergenic
1197329975 X:125141639-125141661 TAACAGAAGAGGAATGAGGAAGG + Intergenic
1197351803 X:125390624-125390646 GTGAGGAACAGGAAAGAAGAAGG + Intergenic
1197476758 X:126934280-126934302 GTGAGGGAGAGGTATGGGGATGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197917202 X:131548916-131548938 GTGAAGAAGTGGCAGAAGGAAGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198084068 X:133266234-133266256 GTGCAGATGAGGAGTGAGGGAGG + Intergenic
1198229146 X:134673191-134673213 AGGAAGAAGAGGAAAGAGGGAGG + Intronic
1198311813 X:135432493-135432515 GGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1198810783 X:140534179-140534201 TGGAAGAAGAGGAAGGAGGGAGG + Intergenic
1199028292 X:142965552-142965574 GTGCAGAAAATGAATTAGGAGGG - Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200314365 X:155116196-155116218 GTAGAGAAGAGGAGTGAAGAGGG - Intronic
1200500768 Y:3946554-3946576 CAAAAGAGGAGGAATGAGGAAGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1201017652 Y:9622463-9622485 GGGAAGAGGAGGTGTGAGGATGG - Intergenic
1201018244 Y:9625832-9625854 GCCAAGAAGAAGAAAGAGGACGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201052332 Y:9950252-9950274 GGGAAGAGGAGGTGTGAGGATGG + Intergenic
1201186638 Y:11411163-11411185 GAAAAGGAGAGGAATGAGGTTGG + Intergenic
1201227684 Y:11834166-11834188 GTGAGGAAGGGGAGTGATGAAGG - Intergenic
1201796583 Y:17903010-17903032 TTGAGGAAGAGGTATGTGGACGG - Intergenic
1201804972 Y:18002975-18002997 TTGAGGAAGAGGTATGTGGACGG + Intergenic
1202241165 Y:22771080-22771102 GGGAAGAGGAGGTGTGAGGATGG - Intergenic
1202394151 Y:24404823-24404845 GGGAAGAGGAGGTGTGAGGATGG - Intergenic
1202476634 Y:25265269-25265291 GGGAAGAGGAGGTGTGAGGATGG + Intergenic