ID: 1180865771

View in Genome Browser
Species Human (GRCh38)
Location 22:19118847-19118869
Sequence TTCTCTACACAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180865771 Original CRISPR TTCTCTACACAGATGGAGAA AGG Intronic
900898108 1:5497862-5497884 TTCTCTCCAGTGATGGAGGAAGG - Intergenic
901079901 1:6578188-6578210 GTCCCTACAGAGATGGTGAAAGG - Intronic
901414338 1:9106344-9106366 TTCTCAACACAGAAGCAGCAGGG + Intronic
901686186 1:10944833-10944855 GGCTCTACAGGGATGGAGAAAGG + Intergenic
904206263 1:28857143-28857165 TTTTCTTCACAGGTGAAGAATGG - Intronic
905027403 1:34860162-34860184 ACCTCTACACAGAAGGGGAAGGG - Intergenic
906666352 1:47624761-47624783 TTCTCCACACAGCTGCAGGAGGG + Intergenic
907812615 1:57886658-57886680 TTCTCTGCACAGCTGGACTAAGG + Intronic
908312711 1:62901457-62901479 TCCTCTTTACAGATGGGGAATGG - Intergenic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
909606124 1:77510035-77510057 TCATCTAACCAGATGGAGAATGG + Intronic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
909903409 1:81166667-81166689 TTCACTTAACAAATGGAGAAAGG - Intergenic
911143456 1:94530510-94530532 ATCTCTACACAAGTGTAGAAAGG - Exonic
914389526 1:147207267-147207289 CTATCTACAGAGATGGGGAAAGG + Intronic
914684228 1:149964283-149964305 TTGTATGCACTGATGGAGAAGGG - Exonic
917062114 1:171052560-171052582 TTCTCTACTCAGAAAGGGAAGGG + Intronic
918326439 1:183415600-183415622 TTATGAACACACATGGAGAATGG - Intronic
919358774 1:196562941-196562963 TTTTCTACACAGAAGGTCAATGG - Intronic
922972798 1:229757409-229757431 TTCTCTATCCAGCTGGAGGAAGG + Intergenic
924617264 1:245622658-245622680 TACTCTGCACAGAAGGAAAATGG - Intronic
1063006447 10:1975484-1975506 TTCCATACACAGATGCAGGAAGG + Intergenic
1063303070 10:4870425-4870447 TTCTCTAAACAGAAAGAAAATGG - Intergenic
1064038238 10:11934335-11934357 TTTTCCTCACAGATAGAGAATGG + Intronic
1064185796 10:13161137-13161159 CTCACTGCACAGATGGTGAAGGG + Intergenic
1064869818 10:19924866-19924888 TTCACTCCCCAGATGGAAAATGG + Intronic
1068329911 10:55549735-55549757 GTCTCTAAACAGATTGAGTAGGG + Intronic
1068773494 10:60848092-60848114 TTCTCTACACAAATCCACAAAGG - Intergenic
1069494074 10:68887244-68887266 GGCTCTACACAGGTTGAGAAAGG + Intronic
1069887355 10:71632436-71632458 TAATCTAGACACATGGAGAATGG + Intronic
1070954622 10:80455587-80455609 TTCCCTTCACAAATAGAGAAGGG - Intronic
1071074940 10:81738809-81738831 TTATCTCAACAGATGCAGAAAGG + Intergenic
1071963937 10:90833200-90833222 TTCTCTACAGTGGTGGAGTAGGG - Intronic
1073730819 10:106285605-106285627 TTCACTAGACAAATGTAGAAGGG + Intergenic
1076377100 10:129997976-129997998 TTTTGTAGACAGATAGAGAAAGG - Intergenic
1077185057 11:1232136-1232158 TTCTCCACACTGAGGGAGCAGGG - Exonic
1079161101 11:17995052-17995074 TGCTGTATACAGAGGGAGAAAGG + Intronic
1079422965 11:20311487-20311509 TTCTCTTCCCACATGGGGAAGGG + Intergenic
1080020228 11:27552398-27552420 TTATTGACAGAGATGGAGAAGGG + Intergenic
1081786269 11:45750010-45750032 TTCTCTACAGAGACCCAGAAAGG - Intergenic
1082697609 11:56388784-56388806 TTCTGTACAGAAATAGAGAAAGG + Intergenic
1082879683 11:58025500-58025522 TTCTCTCCAAAAAGGGAGAAAGG - Intronic
1083409668 11:62483419-62483441 CTCTCTACATAGATCAAGAAAGG + Intronic
1084233423 11:67769925-67769947 ATCTCTACACTGCTGCAGAACGG - Intergenic
1085268520 11:75253574-75253596 TTATCTCAACAGATGCAGAAAGG - Intergenic
1085667201 11:78424961-78424983 TTCTCAACACAAATGTAGGAGGG - Intergenic
1085811702 11:79688475-79688497 TTCTCATCACAGATGAGGAAGGG + Intergenic
1087972136 11:104497513-104497535 TTCAGTACACAGGTGGACAATGG - Intergenic
1087976333 11:104552293-104552315 TTTTTTTCACAGTTGGAGAAGGG - Intergenic
1089280995 11:117374423-117374445 TCCTCCAAACAGATGGAGGATGG - Intronic
1090735216 11:129606859-129606881 TTCTATCCGCAGATGGAGACAGG - Intergenic
1090955548 11:131510393-131510415 TTCTCAGCATAGATGGAGAGTGG + Intronic
1092206525 12:6617814-6617836 ATCTCCACCCAGATGGAGAAAGG + Intergenic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1094500910 12:31020171-31020193 TTCTCCACACAACAGGAGAAAGG + Intergenic
1094502099 12:31030831-31030853 TTCTCTACACAGCTGAGGGATGG + Intergenic
1095282032 12:40363634-40363656 TTCTCTATTCAGAGGCAGAAAGG - Intronic
1099874369 12:88386418-88386440 TTGTCTTCAAATATGGAGAAAGG - Intergenic
1099996162 12:89781356-89781378 CTCTATACACAGACTGAGAAGGG - Intergenic
1104216244 12:126736524-126736546 CTCTCTACAATGATGGAGAATGG - Intergenic
1104236078 12:126937749-126937771 GTCTCCATGCAGATGGAGAAGGG + Intergenic
1106567073 13:30895496-30895518 TGCTCTAAACAGATAGACAAAGG + Intergenic
1107897983 13:44985069-44985091 TTTTCTGCAAAGTTGGAGAATGG + Intronic
1108426432 13:50306364-50306386 TTATCTCAACAGATGGAGAAAGG - Intronic
1109116273 13:58390639-58390661 TTCTCACCACATACGGAGAATGG + Intergenic
1111077506 13:83257139-83257161 TTCGGTGCACAGATGGGGAATGG + Intergenic
1112047926 13:95616348-95616370 TTGTTTTCATAGATGGAGAAAGG - Intronic
1112780492 13:102895503-102895525 TTCTTTGCACAGATGGTCAAAGG - Intergenic
1112927378 13:104693320-104693342 TGCTGTTGACAGATGGAGAATGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114042603 14:18692908-18692930 TTCTCTGCACAGATGGACAGGGG - Intergenic
1114786838 14:25609946-25609968 TTCTTTACACAGCGTGAGAACGG - Intergenic
1116052958 14:39827088-39827110 TTCTGTACAGAGTTGGAGATGGG - Intergenic
1116469579 14:45271427-45271449 TTGTCCACACAGAAAGAGAAAGG - Intergenic
1117171355 14:53101929-53101951 TTCTGAACACAGAATGAGAAAGG + Intronic
1118669697 14:68110408-68110430 ATCTTGAGACAGATGGAGAAAGG - Intronic
1119411143 14:74431308-74431330 CCCTTTACACAGAGGGAGAAAGG - Intergenic
1120963168 14:90143442-90143464 TTCTTTACAAAGATGCTGAAGGG - Intronic
1121972790 14:98374111-98374133 TGCTTTATACAGATGAAGAAGGG - Intergenic
1128411811 15:67406782-67406804 CTCTCTTTACAGATAGAGAAAGG - Intronic
1131362260 15:91803637-91803659 CTCTCTATACAGAGGAAGAAAGG - Intergenic
1132773816 16:1580635-1580657 TTCTTTACACAGTGTGAGAAAGG + Intronic
1134222389 16:12365259-12365281 TTCACTTCGCAGATGAAGAATGG - Intronic
1137366452 16:47863649-47863671 ATTTCTACACAGATGGGGAGTGG + Intergenic
1138309544 16:56011664-56011686 TTCTCTGCAGAGTTGGGGAAGGG + Intergenic
1139194326 16:64900925-64900947 TTCTCTGCAGTGAGGGAGAAGGG + Intergenic
1139207619 16:65044541-65044563 CTCTCTATACAGAAGGAAAAAGG + Intronic
1140116665 16:72047677-72047699 TTTACTACACATATGCAGAATGG + Intronic
1140134480 16:72193615-72193637 TTCCATCCACAGATGGATAATGG - Intergenic
1140305559 16:73799476-73799498 TCATCTGCAAAGATGGAGAAGGG + Intergenic
1141848206 16:86625770-86625792 TGTTTTACACAGATGAAGAAAGG + Intergenic
1142548058 17:719325-719347 TTATCTGCAAAGAGGGAGAAGGG - Intronic
1142824934 17:2504172-2504194 TTTATTACACAGATGGAGAGTGG + Intronic
1143092809 17:4459046-4459068 TGCTCTGGACACATGGAGAAGGG - Intronic
1145968557 17:28939692-28939714 TTCTCTGCACAAATGCAGACAGG + Intronic
1148642394 17:49197932-49197954 TTCTGCACTCAGATGGAGACTGG + Intergenic
1149241230 17:54652147-54652169 CTCTCTCCACATATGCAGAAAGG - Intergenic
1151927010 17:77205277-77205299 TTCTCTCCATAAATGAAGAAGGG + Exonic
1153906365 18:9665245-9665267 GTTTCTAAACAGCTGGAGAAAGG + Intergenic
1156786029 18:40916435-40916457 TTTTCAACAGAGATTGAGAAGGG + Intergenic
1156884665 18:42121019-42121041 GTCTCTAGACAGATAGAAAATGG - Intergenic
1158533010 18:58280344-58280366 TTCCCTACACAGATGGACAGTGG - Intronic
1158826472 18:61225699-61225721 TTTACTACACAGAGGAAGAAAGG + Intergenic
1159562620 18:70011496-70011518 TTATCTCAACAGATGCAGAAAGG + Intronic
1163990229 19:20992104-20992126 TTATCTCAATAGATGGAGAAAGG + Intergenic
927150764 2:20194462-20194484 TCCTCTTCCCTGATGGAGAAGGG - Intergenic
930414514 2:51074477-51074499 ATCTGTACACAGATGAAAAAAGG - Intergenic
930963440 2:57289505-57289527 TTCACTATAAAGATGGAAAACGG + Intergenic
931278572 2:60766663-60766685 TTTTTTAAACAGATGGAGACGGG - Intronic
931829086 2:66032020-66032042 GTCTCTACATAGAAGAAGAAAGG + Intergenic
936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG + Intronic
937397562 2:121551125-121551147 TTATCTCAACAGATGCAGAAAGG + Intronic
937458674 2:122066703-122066725 ATTTCTACTCAGATTGAGAATGG - Intergenic
937659586 2:124415175-124415197 CTCTTTATCCAGATGGAGAATGG - Intronic
938267564 2:129939337-129939359 CTCTCTGCACAGATGGACAGGGG + Intergenic
940446062 2:153778431-153778453 TTCTTTAAAATGATGGAGAAGGG - Intergenic
941285339 2:163605500-163605522 ATCTCTGCACATATGAAGAAAGG + Exonic
941472972 2:165912986-165913008 TTCTTTATACAGAAGGATAAAGG - Intronic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
944604655 2:201341646-201341668 TTCTCACCACAGAGGGAAAATGG - Intronic
945831889 2:214797359-214797381 TTTTCTAGAAAGTTGGAGAAAGG + Intronic
946718399 2:222577743-222577765 TTCTCTACACAAATTAAGACTGG - Intronic
948874580 2:240819923-240819945 TTCTCTGCGGAGATGGAGGAAGG + Intronic
1169163699 20:3405252-3405274 TCATTTTCACAGATGGAGAATGG - Intronic
1170674911 20:18470039-18470061 GTTTCTGGACAGATGGAGAATGG - Intronic
1172988535 20:39013738-39013760 TTCTCTACAAAGAAGCAAAATGG - Intronic
1173446613 20:43124703-43124725 TTTTCTACACGGATGTAGAAAGG - Intronic
1174432073 20:50477693-50477715 TTCTCTATGCTAATGGAGAAAGG + Intergenic
1175063089 20:56261558-56261580 TTCACTACGCAGATGAAGCAGGG - Intergenic
1178262803 21:31115760-31115782 TTCTGTAAACACATGGAGTATGG - Intergenic
1178448121 21:32663930-32663952 GTCTATACACAGATGATGAAGGG + Intronic
1179263051 21:39775564-39775586 TTTTCTTCACAGATGGGAAAAGG + Intronic
1179293187 21:40036923-40036945 TTATCTGCATAGATGCAGAAAGG + Intronic
1180865771 22:19118847-19118869 TTCTCTACACAGATGGAGAAAGG + Intronic
1181388994 22:22565507-22565529 TTCACTGCACAGAGGGAGGAGGG - Exonic
1181918310 22:26298689-26298711 GTCTCTACATAGATAGAGATAGG + Intronic
949940457 3:9150466-9150488 TTCCATGCACAGATGGAGAAAGG + Intronic
951989603 3:28662095-28662117 TTCTCTTCACCAAAGGAGAAGGG + Intergenic
954834973 3:53458382-53458404 TGCTCTACAGTGATGGAAAAAGG + Intergenic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
957871645 3:86096849-86096871 TTATCTCCATAGATGCAGAAAGG + Intergenic
958825354 3:99023165-99023187 TTCTCACCACAAATGCAGAAAGG + Intergenic
960873456 3:122274096-122274118 TCCTCAAAAAAGATGGAGAATGG - Intronic
961445275 3:126977691-126977713 CTCCCTACACAGGAGGAGAAGGG - Intergenic
961932745 3:130550894-130550916 TTATCTCAATAGATGGAGAAAGG - Intergenic
962203669 3:133418284-133418306 TTCTCCTCAGAGCTGGAGAAAGG - Intronic
962449151 3:135497463-135497485 TTCACTGACCAGATGGAGAAAGG + Intergenic
963945686 3:151143728-151143750 TTCTCTACACAGAAGCAAAGTGG + Intronic
964700396 3:159559201-159559223 AACTCTGCACAGATAGAGAAAGG + Intronic
964761622 3:160139919-160139941 AGCTCTGCACAGATGCAGAAAGG - Intergenic
964848341 3:161067869-161067891 TGCTGTAGGCAGATGGAGAAGGG - Intronic
967700795 3:192589958-192589980 TTCTCTACCAAGATGGAGGTTGG + Intronic
968979623 4:3839729-3839751 TTATCTACTCTGATGGAGACAGG - Intergenic
970921609 4:21401273-21401295 TATTCTAGACTGATGGAGAATGG - Intronic
972307549 4:37846358-37846380 TTCTCAACACTGATATAGAATGG - Intronic
973773296 4:54225630-54225652 TTCTCTAAAAAGATCGAGATGGG - Intronic
974868318 4:67606943-67606965 TTCCTTACAAAGATGGTGAAAGG + Intronic
976519622 4:86011321-86011343 TTTTCTCCACAGATGTTGAAAGG - Intergenic
976546530 4:86342134-86342156 TTCCCTACGCAAATGGAGATGGG - Intronic
976652310 4:87449130-87449152 TACTATTCACAGATGGAAAAGGG + Exonic
977432744 4:96952792-96952814 TTCTGTACACAGGTGGAGGTGGG + Intergenic
981542522 4:145860568-145860590 TTATCTCCACAGCTGGAGAGAGG - Intronic
981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG + Intergenic
984470506 4:180165576-180165598 TTCTATAAAAAGGTGGAGAAGGG - Intergenic
984916641 4:184731225-184731247 TTCTCTGCACAGCTGAACAAAGG + Intronic
987351743 5:17028133-17028155 TTATCTTCATAGATGCAGAAAGG + Intergenic
988313164 5:29588086-29588108 TTCTCAATAGAGATAGAGAAAGG + Intergenic
989233731 5:39118878-39118900 TTCTCTGCAGAAATGAAGAAGGG - Exonic
990238720 5:53795695-53795717 TTCTCTGGGCAGATGGAGCAGGG - Intergenic
990252875 5:53934612-53934634 TTCTATTAATAGATGGAGAATGG - Intronic
992426962 5:76667717-76667739 TGTTCTACACAGAGTGAGAAGGG - Intronic
993158726 5:84260782-84260804 TTCTTTACAGAAATGGAGAGAGG - Intronic
993812655 5:92501674-92501696 TTCCCTTCACAAATGGAAAAAGG - Intergenic
997346459 5:133195939-133195961 TTGTCTGGACAGATGGAGATGGG + Intergenic
997368327 5:133339901-133339923 TCCTCTTCAGAGATGGGGAAGGG + Intronic
998297345 5:140984406-140984428 TTTTTTACAGAGATAGAGAAGGG + Intronic
1001318220 5:170659564-170659586 CTCTATACAAAGAAGGAGAAAGG - Intronic
1002945214 6:1754785-1754807 TTATCTCAACAGATGCAGAAAGG + Intronic
1003976802 6:11352196-11352218 TTTTCTAGAGAAATGGAGAAGGG - Intronic
1004740844 6:18459217-18459239 TTCATTAGACAAATGGAGAAGGG - Intronic
1004741154 6:18462573-18462595 TTCATTAGACAAATGGAGAAAGG - Intronic
1006902667 6:37513116-37513138 GTCTCTACAAAGATGGAGGCAGG - Intergenic
1007317490 6:41000944-41000966 TACTCTAATGAGATGGAGAATGG - Intergenic
1007516790 6:42419189-42419211 TTATCTAAAGAGATGGAGACAGG - Intronic
1008021729 6:46586150-46586172 TACTCTAAACACATGAAGAACGG + Intronic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1014519643 6:122425766-122425788 ATCTCTTCACAGAGGAAGAATGG - Intronic
1014791878 6:125681677-125681699 TTCTTTACACAAAAGGAGAGTGG + Intergenic
1018222073 6:161591155-161591177 ATATGTACACAGATGGAGACAGG + Intronic
1019765628 7:2848009-2848031 CTCTCTACACTGCTGGGGAAAGG + Intergenic
1022371628 7:29777028-29777050 TTCTTTACACAGCTGCAGAGTGG - Intergenic
1022432573 7:30340478-30340500 TTATCTCAACAGATGCAGAAAGG - Intronic
1024446093 7:49481015-49481037 TTCTCTAGACATTTGAAGAAAGG - Intergenic
1027980452 7:85213612-85213634 ATTTCTTCACAGATGGATAAAGG + Intergenic
1029982699 7:104894014-104894036 TGCTGTGCACAGATGGAGACTGG - Intronic
1030413452 7:109211684-109211706 TTCTCTCAAAAGATGCAGAAAGG - Intergenic
1031061346 7:117054854-117054876 TTCTTTACAAAGATGAAGAAAGG + Intronic
1032017244 7:128388076-128388098 TTCTCTACACAGAAAGAAAGAGG + Intergenic
1033353663 7:140582529-140582551 TTCTCTTCTCATATGGAAAAGGG - Intronic
1035143151 7:156784782-156784804 AACTCTACACAGATGTAAAAGGG + Intronic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1037499276 8:19469904-19469926 TTTGCTTCACAGAAGGAGAAAGG + Intronic
1040421398 8:47243256-47243278 TTCTCTACCCTGGGGGAGAAAGG + Intergenic
1040543213 8:48377855-48377877 CTCCCTCCACCGATGGAGAAAGG - Intergenic
1041524753 8:58792757-58792779 TTATCTTCACAGAAAGAGAAGGG - Intergenic
1045673111 8:104578834-104578856 TTATCTTGACAGATGCAGAAAGG + Intronic
1047488817 8:125357357-125357379 TTCACTTCACAGAGGCAGAAAGG + Intronic
1047533736 8:125700261-125700283 TTCCAAACACAGATGGAGGAAGG + Intergenic
1048266513 8:132992005-132992027 TTCTCTCCACAGGTGCAGGAGGG + Intronic
1050118238 9:2282313-2282335 TTTTCTACAAAGTTGGAGGAAGG + Intergenic
1050508160 9:6368814-6368836 TTCTCTCCTCAAATGGAGGAAGG - Intergenic
1052466396 9:28835796-28835818 TTCTCTACTCCTATGGAGACTGG + Intergenic
1053073478 9:35114779-35114801 TTCCCTACCCAGAAGGATAAGGG + Intronic
1054777056 9:69132551-69132573 TGCACTACACGGATAGAGAAGGG + Intronic
1055752675 9:79524598-79524620 TTATCTACATGGATGGAGAGAGG + Intergenic
1055793376 9:79947553-79947575 ATCTCTACACAGATGGAGTTTGG - Intergenic
1058475648 9:105329812-105329834 TTTTCCAGACAGATGGGGAAGGG - Intronic
1060418119 9:123447258-123447280 TTCTCTAGATAAATGGAGCAAGG - Intronic
1060503677 9:124181841-124181863 TGCTCTACGCAGATAGAGATGGG - Intergenic
1061169471 9:128943935-128943957 TACACTACACAGATAGTGAATGG - Intronic
1062305390 9:135903639-135903661 ATCTTTACACAAATGGAGGATGG + Intronic
1062333975 9:136056862-136056884 CTTTCTTCCCAGATGGAGAAGGG + Intronic
1185894773 X:3848082-3848104 TTCAGTACCCAGAAGGAGAAAGG + Intergenic
1185899891 X:3886507-3886529 TTCAGTACCCAGAAGGAGAAAGG + Intergenic
1185905007 X:3924935-3924957 TTCAGTACCCAGAAGGAGAAAGG + Intergenic
1186791832 X:13007290-13007312 TCATCTGCACAGAGGGAGAATGG - Intergenic
1188161419 X:26808784-26808806 TTATCTCCATAGATGCAGAAAGG - Intergenic
1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG + Intergenic
1190060014 X:47204744-47204766 TTCTCTGCACATATGGAAACTGG + Intronic
1191685773 X:63888771-63888793 TTATCTCAACAGATGCAGAAAGG + Intergenic
1191830741 X:65413077-65413099 TTCTCTACAAAGATATACAAAGG - Intronic
1193210807 X:78804613-78804635 TTATCTCAATAGATGGAGAAAGG - Intergenic
1196117811 X:112016129-112016151 TTCTCTACAAAGATGGGGGTGGG + Intronic
1201592061 Y:15626397-15626419 GTGTCTAGACAGATAGAGAATGG - Intergenic