ID: 1180869295

View in Genome Browser
Species Human (GRCh38)
Location 22:19137400-19137422
Sequence GTCCCCGATGATGACCTGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180869295_1180869301 18 Left 1180869295 22:19137400-19137422 CCCCCCAGGTCATCATCGGGGAC 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1180869301 22:19137441-19137463 AAAGAGCCCAAAACCACCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 174
1180869295_1180869304 25 Left 1180869295 22:19137400-19137422 CCCCCCAGGTCATCATCGGGGAC 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180869295 Original CRISPR GTCCCCGATGATGACCTGGG GGG (reversed) Exonic