ID: 1180869296

View in Genome Browser
Species Human (GRCh38)
Location 22:19137401-19137423
Sequence AGTCCCCGATGATGACCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180869296_1180869304 24 Left 1180869296 22:19137401-19137423 CCCCCAGGTCATCATCGGGGACT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200
1180869296_1180869301 17 Left 1180869296 22:19137401-19137423 CCCCCAGGTCATCATCGGGGACT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1180869301 22:19137441-19137463 AAAGAGCCCAAAACCACCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180869296 Original CRISPR AGTCCCCGATGATGACCTGG GGG (reversed) Exonic
900447657 1:2689455-2689477 ACTCTCCGATGCTCACCTGGAGG - Intronic
900450509 1:2747235-2747257 ACTCTCCGATGCTCACCTGGAGG - Intronic
901423318 1:9165268-9165290 TGTCCCCGATGAGGGCCTGGGGG + Intergenic
902608917 1:17585678-17585700 ACTCCCCTACAATGACCTGGAGG - Intronic
904400547 1:30253896-30253918 AGTCCCTGATGATGAGGAGGAGG + Intergenic
906076842 1:43058257-43058279 AGGCCGAGATGATGACCAGGAGG + Intergenic
911155727 1:94635031-94635053 AATCCCCAGTGATGCCCTGGGGG - Intergenic
912715714 1:111982336-111982358 AGTCCCCGATGATCTCCGGGAGG + Exonic
920698122 1:208197382-208197404 AGTCACCGAAGCTGAACTGGGGG + Intronic
1070782179 10:79143991-79144013 AGTCCCCGATGCAGAGTTGGAGG - Intronic
1073540181 10:104311528-104311550 AGCCCCCGTTGAGAACCTGGGGG - Exonic
1074216032 10:111384561-111384583 AATCCACCATGATGACTTGGTGG + Intergenic
1075147255 10:119892820-119892842 AGTGCCCGATGAGGAAGTGGAGG - Exonic
1079052299 11:17172794-17172816 AATCACCGATGATGAAGTGGAGG - Intronic
1080436815 11:32252548-32252570 AGTCCCCCATCATGACTAGGAGG + Intergenic
1083694390 11:64433006-64433028 AGGGCCTGATGATTACCTGGTGG - Intergenic
1089365461 11:117918521-117918543 TGTCACCGAGGCTGACCTGGCGG + Exonic
1089684993 11:120141074-120141096 AGTCCCAGATCATGCCCTTGGGG + Intronic
1115808964 14:37084341-37084363 GGTACCTGATGATGAACTGGTGG + Intronic
1121835543 14:97088860-97088882 AGGCACAGAGGATGACCTGGAGG + Intergenic
1131253381 15:90845540-90845562 AGGCCCCCAAAATGACCTGGAGG + Intergenic
1132710186 16:1262959-1262981 CGTCCCAGAGAATGACCTGGTGG - Intergenic
1132712673 16:1276476-1276498 CGTCCCCGAGAATGACCTGGTGG - Intergenic
1135081589 16:19440805-19440827 AGACCCCAAAGATGACCAGGGGG + Exonic
1139952188 16:70677842-70677864 AGTCGTCGATGATGCCCTGCAGG + Exonic
1141702696 16:85649846-85649868 AGGCCCTGATGATGAGCAGGTGG - Intronic
1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG + Intronic
1144638669 17:16926096-16926118 AGTCCCCCATGAGGAGCTGCAGG - Intergenic
1147331895 17:39704275-39704297 GGTCCCCGTTGATTTCCTGGGGG - Intronic
1154285549 18:13053060-13053082 AGCCACAGATGATGCCCTGGAGG + Exonic
1163804964 19:19390306-19390328 AATCCGAGATGATGAACTGGAGG + Intronic
1166385898 19:42380738-42380760 AGTCCACGATCATATCCTGGAGG - Intergenic
1166941952 19:46372570-46372592 AATCCCCGAAGAAGCCCTGGGGG - Intronic
1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG + Exonic
932085709 2:68756823-68756845 AGTGCCTGATGAAGACCTGATGG + Intronic
932730728 2:74220201-74220223 ACTCCCTGATGATGACATAGTGG - Intronic
936469040 2:112781628-112781650 CATCACTGATGATGACCTGGAGG - Exonic
1169346972 20:4836288-4836310 AGGCCACGATGAGGAGCTGGGGG + Intergenic
1176724011 21:10414863-10414885 AGTCCCCTGTGGTGAGCTGGAGG + Intergenic
1177160720 21:17545175-17545197 AGAGCTGGATGATGACCTGGAGG - Intronic
1179098284 21:38334999-38335021 TGTCCCCGACGATGACCTAATGG - Intergenic
1180305255 22:11068037-11068059 AGTCCCCAGTGGTGAGCTGGAGG + Intergenic
1180869296 22:19137401-19137423 AGTCCCCGATGATGACCTGGGGG - Exonic
1181113144 22:20613475-20613497 AGTTCCCGATGAGGAGCAGGTGG - Intergenic
1181568393 22:23753094-23753116 AGTCCCTGATGGTGACGTGCTGG + Exonic
1183862663 22:40681019-40681041 AGTTCCCGATGATGCCCAGGAGG - Exonic
952854266 3:37754960-37754982 TTTCCCCAAGGATGACCTGGAGG + Intronic
957906307 3:86560633-86560655 AATCCCCAATGTTGGCCTGGTGG - Intergenic
966905806 3:184525397-184525419 AGTCCCCGAGGATCACCTGCGGG - Intronic
966933444 3:184690600-184690622 AGTCCCCTATGAAGGCCTGGAGG - Intergenic
968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG + Intergenic
968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG + Intergenic
972893186 4:43585585-43585607 AGACCTAGATGATGACCTTGAGG - Intergenic
983827236 4:172278505-172278527 AGCCCAGGATGATGACCAGGAGG - Intronic
997976693 5:138445350-138445372 AGTCCTCGATGGTGTCCAGGAGG - Exonic
1001700597 5:173704029-173704051 AGTGCCCGGTGATGAGCTGCAGG + Intergenic
1002724151 5:181283394-181283416 AGTCCCCTGTGGTGAGCTGGAGG + Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1016882840 6:148927992-148928014 AGTCCCCAGTGAAGGCCTGGAGG + Intronic
1017875222 6:158518481-158518503 GGTTCCCGAAGATGATCTGGAGG + Intergenic
1020690871 7:11353239-11353261 AGTCCTCGGAGATGACCTGTAGG + Intergenic
1026249631 7:68658187-68658209 AATCTCCAATGCTGACCTGGGGG - Intergenic
1028850924 7:95536529-95536551 TATCCCCGATGATGACTTGGAGG + Exonic
1029212384 7:98919644-98919666 AGTCCCTGCTGGTCACCTGGAGG + Intronic
1034969723 7:155411354-155411376 AGACCCCCCAGATGACCTGGAGG - Intergenic
1035745985 8:1962389-1962411 AGCCCACGATGCTGAGCTGGGGG - Intergenic
1043087192 8:75849514-75849536 AGTCCCCCGTGAGGACCTGAAGG - Intergenic
1052852339 9:33385746-33385768 ACACCCCGATGATGACCACGAGG + Exonic
1058909138 9:109505161-109505183 CTTCCCCCATGGTGACCTGGTGG - Intergenic
1060177274 9:121506242-121506264 AGTCCCTGGTGAACACCTGGGGG + Intergenic
1061822867 9:133238401-133238423 AGGCCCTGCTGGTGACCTGGAGG - Intergenic
1062181111 9:135191779-135191801 AGTGCCCGAGGGTGACCTGGGGG + Intergenic
1203782632 EBV:109126-109148 GGGCCCCGGTCATGACCTGGTGG - Intergenic
1187821953 X:23297359-23297381 AGTCCCTGATGACAACATGGAGG - Intergenic
1200140634 X:153901154-153901176 ACTCTCACATGATGACCTGGAGG + Intronic