ID: 1180869296 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:19137401-19137423 |
| Sequence | AGTCCCCGATGATGACCTGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 75 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 66} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180869296_1180869304 | 24 | Left | 1180869296 | 22:19137401-19137423 | CCCCCAGGTCATCATCGGGGACT | 0: 1 1: 0 2: 0 3: 8 4: 66 |
||
| Right | 1180869304 | 22:19137448-19137470 | CCAAAACCACCTCAGGCCAGAGG | 0: 1 1: 0 2: 1 3: 20 4: 200 |
||||
| 1180869296_1180869301 | 17 | Left | 1180869296 | 22:19137401-19137423 | CCCCCAGGTCATCATCGGGGACT | 0: 1 1: 0 2: 0 3: 8 4: 66 |
||
| Right | 1180869301 | 22:19137441-19137463 | AAAGAGCCCAAAACCACCTCAGG | 0: 1 1: 0 2: 2 3: 10 4: 174 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180869296 | Original CRISPR | AGTCCCCGATGATGACCTGG GGG (reversed) | Exonic | ||