ID: 1180869298

View in Genome Browser
Species Human (GRCh38)
Location 22:19137403-19137425
Sequence CGAGTCCCCGATGATGACCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180869298_1180869301 15 Left 1180869298 22:19137403-19137425 CCCAGGTCATCATCGGGGACTCG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1180869301 22:19137441-19137463 AAAGAGCCCAAAACCACCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 174
1180869298_1180869304 22 Left 1180869298 22:19137403-19137425 CCCAGGTCATCATCGGGGACTCG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180869298 Original CRISPR CGAGTCCCCGATGATGACCT GGG (reversed) Exonic